WWW.KN.LIB-I.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Различные ресурсы
 

Pages:   || 2 |

«УЧАСТИЕ КАНОНИЧЕСКОГО СИГНАЛЬНОГО ПУТИ WNT В РЕГУЛЯЦИИ ПЛАСТИЧНОСТИ ГИППОКАМПА ...»

-- [ Страница 1 ] --

Федеральное Государственное Бюджетное Учреждение Науки

Институт Высшей Нервной Деятельности и Нейрофизиологии РАН

На правах рукописи

Иванова Ольга Ярославовна

УЧАСТИЕ КАНОНИЧЕСКОГО СИГНАЛЬНОГО ПУТИ WNT В

РЕГУЛЯЦИИ ПЛАСТИЧНОСТИ ГИППОКАМПА

Специальность 03.03.01 – «Физиология»

Диссертация

на соискание ученой степени кандидата биологических наук

Научный руководитель:

кандидат биологических наук Владимир Александрович Маркевич Москва 2017

ОГЛАВЛЕНИЕ

СПИСОК СОКРАЩЕНИЙ

ВВЕДЕНИЕ

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

1.1. Сигнальные пути Wnt и их взаимодействие.

1.2. Экспрессия белков Wnt в период постнатального развития................ 16

1.3. СП Wnt в регуляции поведения

1.4. Участие СП Wnt в патогенезе нейродегенеративных заболеваний и психических расстройств.

1.5. СП Wnt в регуляции пластичности синаптической передачи............. 23

1.6. Роль белков СП Wnt в пре- и постсинаптических процессах.............. 25

1.7. Заключение

ГЛАВА 2. МЕТОДЫ ИССЛЕДОВАНИЯ

2.1. Схема эксперимента

2.2. Создание лентивирусных конструкций

2.3. Инъекции лентивирусных конструкций



2.4. Электрофизиологическое исследование на наркотизированных животных in vivo

Вживление электродов

2.4.1.

Электрофизиологический эксперимент

2.4.2.

Обработка результатов

2.4.3.

2.5. Биохимический анализ изменений СП Wnt в гиппокампе.................. 33 Изъятие гиппокампов

2.5.1.

Гомогенизация

2.5.2.

Оценка количества белка

2.5.3.

Электрофорез белков в полиакриламидном геле

2.5.4.

Вестерн блоттинг

2.5.5.

Иммуноферментный анализ (ИФА)

2.5.6.

Обработка результатов.

2.5.7.

2.6. Определение киназной активности GSK-3.

2.7. Оценка распространения лентивирусных конструкций в гиппокампе.38 Изготовление срезов гиппокампа

2.7.1.

Иммуногистохимический анализ

2.7.2.

ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

3.1. Распространение лентивирусной конструкции в гиппокампе и эффективность заражения.

3.2. Влияние хронического подавления и усиления СП Wnt на синаптическую пластичность.

Сравнение контрольных групп

3.2.1.

Динамика изменения долговременной потенциации in vivo в 3.2.2.

результате хронического подавления СП Wnt.

Динамика изменения долговременной потенциации in vivo в 3.2.3.

результате хронического усиления СП Wnt.

Заключение

3.2.4.

3.3. Пресинаптические изменения в результате хронического подавления и усиления СП Wnt.

Сравнение контрольных групп

3.3.1.

Динамика изменения коэффициента ПФ в результате 3.3.2.

лентивирусной трансдукции.

Изменения исходного коэффициента ПФ (до тетанизации) в 3.3.3.

результате лентивирусной трансдукции.

Зависимость амплитуды ДП от исходного коэффициента ПФ.. 53 3.3.4.

Заключение

3.3.5.

3.4. Постсинаптические изменения в результате хронического подавления и усиления СП Wnt.





3.5. Изменение экспрессии белков СП Wnt в гомогенатах гиппокампа через 14 дней после лентивирусной трансдукции.

Сравнение контрольных групп.

3.5.1.

Изменения уровня -катенина в результате хронического 3.5.2.

подавления и усиления СП Wnt

Изменения уровней Циклина D1 и c-Myc в результате 3.5.3.

хронического подавления и усиления СП Wnt.

Изменения уровня экспрессии и активности в 3.5.4. GSK-3 результате хронического подавления и усиления СП Wnt.

Изменения уровней экспрессии -катенина, GSK-3 и их 3.5.5.

фосфорилированных форм в ядерных фракциях гомогенатов гиппокампа.

Заключение

3.5.6.

ГЛАВА 4. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

4.1. Пресинаптические механизмы нарушения ДП in vivo при хроническом подавлении СП Wnt

4.2. Постсинаптические механизмы увеличения амплитуды ДП in vivo на фоне хронической оверэкспрессии Wnt3

4.3. Роль -катенина в реализации влияния СП Wnt на синаптическую пластичность

4.4. Участие целевых белков СП Wnt в реализации влияния подавления и усиления каскада на синаптическую пластичность

4.5. Роль GSK-3 в регуляции синаптической пластичности посредством лентивирусного подавления и усиления СП Wnt

ЗАКЛЮЧЕНИЕ

ВЫВОДЫ

БЛАГОДАРНОСТИ

СПИСОК ЛИТЕРАТУРЫ

СПИСОК СОКРАЩЕНИЙ

БА – болезнь Альцгеймера ДП – долговременная потенциация ПФ – парная фасилитация СП Wnt – сигнальный путь Wnt фВПСП – фокальные возбуждающие постсинаптические потенциалы AICD – amyloid precursor protein intracellular domain (внутриклеточный домен белка-предшественника -амилоидного пептида) APC – adenomatous polyposis coli (белок - продукт гена опухолевого супрессора) APP – amyloid precursor protein (белок – предшественник -амилоидного пептида) APV – 2-amino-5-phosphonovaleric acid (D-2-аминофосфонвалерьяновая кислота) ATF2 – activating transcription factor 2 (транскрипционный фактор) A – amyloid (-амилоидный пептид) BDNF– brain-derived neurotrophic factor (нейротрофический фактор мозга) BMP – bone morphogenetic protein (костный морфогенетический белок, фактор роста) CaMKI – Ca2+/calmodulin-dependent protein kinase type I (Ca2+-кальмодулин зависимая протеинкиназа типа I) CaMKII – Ca2+/calmodulin-dependent protein kinase type II (Ca2+-кальмодулин зависимая протеинкиназа типа II) CaMKIV – Ca2+/calmodulin-dependent protein kinase type IV (Ca2+-кальмодулин зависимая протеинкиназа типа IV) Ca2+/calmodulin-dependent

– CaMKK protein kinase kinase (киназа, фосфорилирующая Ca2+-кальмодулин зависимые протеинкиназы) cGMP – cyclic guanosine monophosphate (циклический гуанозинмонофосфат) CK-1 – casein kinase 1 (казеин киназа 1) CREB – cAMP response element-binding protein (транскрипционный фактор) Dkk1 – dickkopf-related protein 1 (белок – антагонист СП Wnt) Dvl – disheveled (цитоплазматический фосфопротеид, регулирующий клеточную пролиферацию) Fzd – frizzled (рецептор СП Wnt) GSK-3 – glycogen synthase kinase 3 (киназа 3 гликоген синтазы) JNK – с-Jun N-Terminal kinase (киназа, фосфорилирующая белок с-Jun) LEF – lymphoid enhancer-binding factor (транскрипционный фактор) LRP5/6 – low-density lipoprotein receptor-related protein, isoforms 5 or 6 (трансмембранный рецептор липопротеинов низкой плотности) MEK/ERK – extracellular signal-regulated kinase (центральная киназа сигнального пути MAPK) NFAT – nuclear factor of activated T-cells (транскрипционный фактор, участвующий в реализации иммунного ответа) NMDA – N-Methyl-D-aspartate (n-метил-d-аспартат) PCNA – (вспомогательный фактор proliferating cell nuclear antigen репарационной ДНК-полимеразы дельта) PKC – protein kinase C (протеинкиназа С) PS-1 – presenilin 1 (трансмембранный белок, являющийся частью протеазного комплекса -секретазы) PSD-95 – postsynaptic density protein 95 (белок постсинаптической плотности) ROCK – Rho-associated protein kinase (протеинкиназа, активируемая белком Rho) SV-2 – synaptic vesicle glycoprotein 2 (гликопротеин синаптических везикул) TCF – T-cell factor (T-клеточный транскрипционный фактор) WASP-1 – Wnt-activating small molecule potentiator-1 (активатор сигнального пути Wnt) WIF – Wnt Inhibitory Factor (белок, связывающийся с белками Wnt и ингибирующий их активность)

ВВЕДЕНИЕ

Актуальность проблемы Сигнальный путь Wnt (СП Wnt)– один из активно изучаемых внутриклеточных сигнальных каскадов. Он является активным участником разнообразных биологических процессов как в период созревания, так и у взрослых особей (Nusslein-Volhard, Wieschaus 1980; McMahon, Moon, 1989;

Chen et al., 2006; Jessberger et al., 2009; Vargas et al., 2014). Нарушения в работе каскада Wnt связывают с неврологическими (аутизм, шизофрения, биполярное расстройство) и нейродегенеративными заболеваниями (болезнь Альцгеймера, болезнь Гентингтона и болезнь Паркинсона) (Anderton, 2000;

Boonen et al., 2009; Clevers and Nusse, 2012; Blalock et al., 2004; Hooper et al., 2008; Vogt et al., 2011; De Ferrari and Moon, 2006). В настоящее время у позвоночных описаны 19 генов семейства Wnt. Экспрессия генов семейства Wnt отмечается на разных стадиях развития в различных отделах ЦНС, в том числе в обонятельной луковице, гиппокампе, неокортексе и таламусе (Gavin et al., 1990, Shimogori et al., 2004; Wayman et al., 2006; Cerpa et al., 2008; Davis et al., 2008).

Согласно современным представлениям, СП Wnt контролирует клеточную дифференцировку, миграцию нейронов, а также играет важную роль в модуляции работы зрелых синапсов (Маркевич и др., 2012). Показано, что канонический каскад Wnt регулирует нейрогенез в зубчатой фасции гиппокампа – процесс, отражающий структурную пластичность гиппокампа (Lie et al., 2005; Jessberger et al., 2009).

Общепринятой моделью для изучения процессов пластичности является долговременная посттетаническая потенциация (ДП), которая представляет собой долговременное изменение эффективности синаптических связей (Bliss, 1973). Исследования Lomo, in vitro продемонстрировали влияние фармакологических ингибиторов и активаторов сигнального пути Wnt на долговременную потенциацию в срезах гиппокампа (Chen et al. 2006: Cerpa et al, 2011; Vargas et al, 2014;

Vargas, 2015). Однако феномен ДП in vitro не в полной мере отражает роль СП Wnt в регуляции синаптической пластичности. На уровне целого мозга исследовалось лишь участие каскада Wnt в процессах обучения и формирования памяти: было показано, что он влияет на распознавание объектов и пространственную память (Maguschak, Ressler, 2008; Jessberger et al., 2009; Fortress et al., 2013). Очевидно, что остается недостачно изученным вопрос о регуляции синаптической пластичности in vivo путем подавления и усиления сигнального пути Wnt.

Для исследований на основе более сложной, но более реалистичной модели синаптической пластичности - ДП in vivo - требуется обеспечение хронических изменений в СП Wnt с минимальным оперативным вмешательством. В данной работе применен метод локального хронического изменения экспрессии генов Wnt в зрелом мозге – инъекции суспензий лентивирусных конструкций непосредственно в изучаемую структуру. Для изучения положительной модуляции канонического СП Wnt был выбран лиганд каскада Wnt3, который был ранее использован для изучения участия СП Wnt как в регуляции ДП in vitro (Chen et al., 2006), так и в нейрогенезе в зубчатой фасции гиппокампа (Lie et al., 2005). Для отрицательной модуляции применяли доминантно-негативную мутацию гена Wnt1, также ранее уже применявшуюся для изучения нейрогенеза в зубчатой фасции гиппокампа с помощью лентивирусной трансдукции (Lie et al., 2005; Jessberger et al., 2009).

Аномальный белок Wnt1 занимает рецепторы и корецепторы СП Wnt, не позволяя нормальным лигандам канонического пути, в том числе Wnt3 (Lie et al., 2005), активировать каскад. В данной работе впервые метод лентивирусной трансдукции применяется для изучения регуляции ДП in vivo лигандами и компонентами СП Wnt.

Присутствие компонентов канонического СП Wnt в разных областях мозга, а также его активное участие в нейрогенезе, обработке сенсорных сигналов и когнитивных функциях указывает на его фундаментальное значение в работе нервной системы. Каскад Wnt играет важную роль в реализации синаптической пластичности, однако изучение механизмов его действия все еще остается актуальной научной проблемой.

Цель работы и основные задачи исследования.

Основной целью работы было исследовать роль сигнального пути Wnt в регуляции синаптической пластичности гиппокампа.

Для этого были поставлены следующие задачи:

1. Обеспечить хроническое подавление и усиление сигнального каскада Wnt локально в области СА1 гиппокампа крыс методом лентивирусной трансдукции.

2. Исследовать влияние модуляции канонического каскада Wnt на долговременную потенциацию in vivo.

3. Выявить механизмы, лежащие в основе эффектов воздействия сигнального пути Wnt на синаптическую пластичность, с помощью оценки изменений коэффициента парной фасилитации и экспрессии ключевых компонентов каскада, а также белка постсинаптической плотности.

Научная новизна Впервые продемонстрировано влияние хронического in vivo подавления и усиления канонического сигнального пути Wnt на синаптическую пластичность. Подтверждена гипотеза об ухудшении условий для возникновения и поддержания долговременной потенциации при подавлении каскада и их улучшении при его усилении. Показано, что наблюдаемое подавление долговременной потенциации сопровождается нарушением пресинаптических функций, в то время как усилению сигнального пути сопутствуют постсинаптические перестройки.

Wnt Детально исследовано влияние лентивирусной трансдукции на экспрессию ключевых компонентов каскада.

Теоретическая ценность и практическая значимость.

Нарушения в работе каскада Wnt связывают как с неправильным эмбриональным развитием, так и с неврологическими и нейродегенеративными патологиями, в основе которых лежат изменения в пластичности синаптических связей. В последние десятилетия все больше данных свидетельствуют о том, что СП Wnt является важным участником процессов синаптической пластичности. Полученные результаты позволяют оценить его роль в их реализации и предположить возможные механизмы их регуляции. Более того, сигнальный путь Wnt и его компоненты являются перспективной мишенью для разработки методов лечения различных неврологических и нейродегенеративных патологий, а использованный в данной работе метод лентивирусной трансдукции может быть в дальнейшем применен в клинической практике для коррекции нарушений путем локального хронического изменения экспрессии белков каскада неспосредственно в целевой структуре ЦНС.

Положения, выносимые на защиту:

1. Хроническое подавление канонического сигнального пути Wnt приводит к угнетению синаптической пластичности, выраженному в нарушении индукции и поддержания ранней фазы долговременной потенциации in vivo

2. Хроническая оверэкспрессия лиганда канонического каскада Wnt3 обеспечивает усиление пластичности синаптических связей, выраженное в облегчении индукции долговременной потенциации in vivo

3. Регуляция синаптической пластичности сигнальным каскадом Wnt реализуется преимущественно через пресинаптические механизмы, а оверэкспрессия белка приводит к постсинаптическим Wnt3 перестройкам Апробация работы Основные результаты работы были доложены на международных конференциях: двух региональных Европейских форумах по нейронаукам (Прага, 2013; Фессалоники, 2015), 9-м Европейском форуме по нейронаукам (Милан, 2014); на школах-конференциях молодых ученых ИВНД и НФ РАН (Москва, 2012, 2013) и апробированы на межлабораторной конференции ИВНД и НФ РАН (Москва, 2015).

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

Сигнальный путь Wnt (СП Wnt)– один из активно изучаемых внутриклеточных сигнальных каскадов, регулирующий эмбриогенез и дифференцировку клеток, а также развитие раковых опухолей. Первым белком семейства Wnt стал мышиный Int1 (ныне известный, как Wnt1). Nusse и Varmus (Nusse, Varmus, 1982) определили Int1 как новый протоонкоген, активируемый ретровирусом мышиной опухоли молочной железы. Ранее Nusslein-Volhard и Wieschaus (Nusslein-Volhard, Wieschaus, 1980) показали, что у Drosophila с мутациями по некоторым генам в период эмбриогенеза имеются либо дефекты в количестве сегментов, либо нарушение полярности.

Один из этих генов, названных “генами сегментарной полярности”, ген Wingless, был известен ранее как ген, мутация которого приводит к нарушению в развитии крыльев (Sharma, Chorpa, 1976). Позже Rijsewijk с соавторами (Rijsewijk et al., 1987) показали, что Wingless является гомологом Int1. Таким образом, связь протоонкогена с эмбриональным развитием может служить в пользу гипотезы о возникновении рака, как следствия неправильной пролиферации и дифференцировки клеток. В других работах, посвященных этому вопросу (McMahon, Moon, 1989), показано участие Int1 в эмбриональном формировании осей у Xenopus laevis. В 1990 году ген Int1 и родственные ему (например, ген Wingless) объединили в семейство с гибридным именем Wingless-related integration site (Wnt) (Nusse et al., 1991).

На данный момент охарактеризовано 19 генов Wnt у позвоночных. Все белки Wnt — это гликопротеины размером около 40 кДа, которые обладают чертами, характерными для секретируемых факторов роста (Куликова и др., 2012). Пары генов иногда выделяют в подсемейства, если они сходны по структуре, как например, Wnt5a и Wnt5b или Wnt7a и Wnt7b. Каждый из них принимает участие и в развитии нервной системы, и в обеспечении нормальной активности уже сформировавшегося мозга. Экспрессия генов семейства Wnt отмечается на разных стадиях развития в различных клетках ЦНС (Gavin et al., 1990). Гены семейства Wnt cуществуют в геномах животных уже более 600 млн лет, что дает основание предположить их глобальное значение в становлении первичной оси тела животного (Niehrs, 2010). У одноклеточных организмов и у растений гены Wnt отсутствуют.

Однако даже представители беспозвоночных такие, как, например, Hydra и Nematostella, обладают таким же количеством подсемейств Wnt, как и позвоночные (Kusserow et al., 2005). Предполагается, что чем шире и разнообразнее семейство Wnt, тем сложнее строение тела животного (Sidow, 1992).

Сигнальные пути Wnt и их взаимодействие.

1.1.

В настоящее время механизмы воздействия на клетку Wnt подразделяют канонический и неканонические (Veeman et al., 2003; Nelson, Nusse, 2004). Первый из них, канонический или путь Wnt/-катенин, наиболее хорошо изучен. Он контролирует стабильность -катенина, образующего комплекс с белком TCF для регуляции транскрипции целевых генов (Shimizu et al., 1997). Изменение уровня -катенина/TCF связывают с развитием различных видов рака (Reya, Clevers, 2005; Куликова и др., 2012;

Москалев и др., 2007; Люлько и др., 2012). Канонический каскад Wnt регулирует клеточную дифференцировку, пролиферацию (Toledo et al., 2008;

Niehrs, 2010) и специализацию в процессе развития (Cadigan, Nusse, 1997).

Неканонические действуют либо через киназу JNK (путь планарной полярности клетки или Wnt/JNK путь), либо через G-белок (путь Ca2+) (Boutros et al., 1998; Kohn, Moon, 2005).

В отсутствие активации канонического сигнального пути Wnt происходит снижение уровня -катенина в цитоплазме клетки за счет работы «комплекса деградации -катенина», состоящего из белков: аксина, GSK-3, CK-1 и APC (Sugimura, Li, 2010). Киназы CK-1 и GSK-3 последовательно фосфорилируют -катенин, что приводит к его протеасомной деградации

-катенин c одной стороны является (Nusse, Varmus, 2012).

транскрипционным кофактором вместе с белками TCF и LEF (Clevers, Nusse, 2012), а с другой – адапторным белком, связывающим белки кадгерины с актиновым цитоскелетом для участия в клеточной адгезии (Nelson, Nusse, 2004; Глушанкова, 2003).

Для воздействия на клетку-мишень Wnt связывается с клеточными рецепторами. В качестве таких рецепторов на поверхности клетки выступают трансмембранный белок Fzd и белки LRP5/LRP6. Эти рецепторы формируют комплекс с белком Dvl, олигомеризующимся на плазматической мембране и создающим платформу для привлечения комплекса деградации -катенина (Bilic et al., 2007; Катанаев, 2010). Затем CK-1 фосфорилирует LRP5/6 рецептор, что приводит к ингибированию комплекса деградации -катенина (рис. 1А). Таким образом, -катенин стабилизируется, накапливается в цитоплазме и может входить в ядро для активации транскрипции ряда целевых генов (Logan, Nusse, 2004), включая c-Myc, циклин D1, аксин 2 и CaMKIV (Arrzola et al., 2009; Toledo et al., 2008; Nusse, Varmus, 2012).

Неканонический каскад Wnt также разделяют на два различных пути и классифицируют их по участвующим в них рецепторам и ко-рецепторам Wnt, либо по внутриклеточному сигналу, который они проводят: путь планарной полярности клетки (PCP) и путь Са2+. Путь Wnt/PCP или путь Wnt/JNK запускается через киназу JNK (Boutros et al., 1998). Wnt связывается с рецептором Fzd на поверхности мембраны и активирует малые ГТФазы Rho и Rac, которые координируют работу протеинкиназ ROCK и JNK (рис. 1Б).

Показано, что каскад Wnt/PCP регулирует организацию цитоскелета, подвижность клетки и экспрессию генов с помощью JNK-зависимых транскрипционных факторов, например, ATF2 (Simons, Mlodzik, 2008).

Путь Wnt/Ca2+ является сигнальным каскадом, зависимым от G-белка (Slusarski et al., 1997a; Kohn, Moon, 2005). Для его активации необходимо связывание на поверхности мембраны лиганда Wnt с рецептором Fzd, который взаимодействует с белком Dvl и гетеротримерным G-белком (Slusarski et al., 1997a,b), что приводит к увеличению активности фосфолипазы С. Фермент стимулирует образование диацилглицерола и инозитол-1,4,5-трифосфата. Последний инициирует увеличение выброса кальция из внутриклеточных депо, что приводит к уменьшению количества активации и серин-треониновой фосфатазы cGMP, CaMKII, PKC кальциневрина (Veeman et al., 2003; Kohn, Moon, 2005). Кроме того, запуск каскада инициирует несколько транскрипционных факторов, включая CREB и NFAT, участвующий в регуляции клеточной адгезии и миграции (De et al., 2011) (рис. 1Б).

Рисунок 1. А.

Канонический сигнальный путь Wnt (путь Wnt/-катенин); Б.

Неканонические сигнальные пути Wnt (путь планарной полярности клетки и путь Ca2+).

Активация каждого из путей (канонического или неканонического) происходит при связывании белков семейства Wnt с разными видами корецепторов. Показано, что такие лиганды, как Wnt1, Wnt3a и Wnt8, образуя комплекс с Fzd рецептором и с ко-рецептором LRP5/6 (MacDonald et al., 2009), запускают канонический СП Wnt. Такие лиганды, как Wnt4, Wnt5a или Wnt11, инициирующие неканонический путь, могут действовать не только через рецепторы Fzd (Angers, Moon, 2009). Например, Wnt5a влияет на процессы развития и миграции клеток с помощью рецептора Ror2 (Schambony, Wedlich, 2007). Однако лиганд канонического каскада Wnt3a, связывающийся с ко-рецепторами LRP5/6, и лиганд неканонического каскада Wnt5a, взаимодействующий с ко-рецептором Ror2, используют для этого общие внутриклеточные компоненты, включая Dvl1, аксин и GSK-3.

Показано, что если поменять внеклеточный домен LRP6 на внеклеточные домены Ror1 или Ror2, то Wnt5a, а не Wnt3a, индуцирует фосфорилирование внутриклеточного домена LRP6 и активирует канонический путь. Таким образом, данные экспериментов in vitro демонстрируют, что Wnt5a и Wnt3a конкурируют за связывание с Fzd рецептором (Grumolato et al., 2010).

Другим ключевым компонентом обоих каскадов является белок Dvl, содержащий в себе N-терминальный домен DIX, центральный домен PDZ и С-терминальный домен DEP. В каноническом СП используются домены DIX и PDZ, в неканоническом – PDZ и DEP. Молекулярным переключателем между каноническим и неканоническим СП является Dvl (Wallingford, Habas, 2005).

Исходя из приведенных выше данных, можно заключить, что в одной и той же клетке активация различных СП Wnt зависит от экспрессирующихся в ней ко-рецепторов. Кроме того, между каноническим и неканоническим сигнальными каскадами имеется реципрокная регуляция (Grumolato et al., 2010).

Экспрессия белков Wnt в период постнатального развития 1.2.

В ходе постнатального развития белки семейства Wnt участвуют в формировании нейронных связей, помогают новообразованным синапсам в создании и закреплении межклеточных взаимодействий. Компоненты каскада лежат в основе синаптических перестроек и пластичности в течение всей жизни (Lu, 2003; Speese, Budnik, 2007).

Лиганды Wnt и некоторые компоненты каскада были найдены во многих структурах мозга: обонятельной луковице, гиппокампе, неокортексе и таламусе (Shimogori et al., 2004; Wayman et al., 2006; Cerpa et al., 2008;

Davis et al., 2008). Кроме того, методом флуоресцентной гибридизации in situ показана экспрессия Wnt лигандов в зонах активного нейрогенеза, например, в обонятельной луковице и зубчатой извилине гиппокампа (Shimogori et al., 2004). Показано, что в субгранулярной зоне гиппокампа мыши в период постнатального развития происходит постепенное нарастание экспрессии мРНК компонентов СП Wnt, белков Wnt3a и -катенина, а также компонентов клеточного цикла – циклина D1 и маркера пролиферации PCNA. Судя по всему, экспрессия этих белков необходима для поддержания нормального хода нейрогенеза в зрелом мозге (Kumar et al., 2012).

Нейрогенез в гиппокампе связан в первую очередь с процессами пластичности, обучения и памяти (Аниол и др. 2016). Однако с возрастом и при нейродегенеративных заболеваниях (например, при болезни Альцгеймера) его интенсивность падает, что коррелирует со снижением экспрессии компонентов сигнального пути Wnt/-катенина (Lie et al., 2005;

2009), играющего важную роль в регуляции Jessberger et al., дифференцировки нервных стволовых клеток или клеток–предшественников.

Wei с соавторами (Wei et al., 2012) показали, что радиоактивное облучение в низких дозах (0.3 Gy) стимулирует нейрогенез в гиппокампе, а также повышает экспрессию белков Wnt1, Wnt3a, Wnt5a и -катенина в нервных стволовых клетках и в гиппокампе in situ. Эти изменения сопровождаются улучшением обучения животных в водном лабиринте Морриса. Высокие дозы радиоактивного излучения (3.0 Gy) оказывают противоположное действие на экспрессию компонентов СП Wnt/ -катенин, нейрогенез и обучение (Маркевич и др., 2012).

Более того, изменение активности компонентов сигнального каскада Wnt затрагивает не только гиппокамп, но и таламус, передающий сенсорную информацию в кору (Shimogori et al., 2004; Wisniewska, 2013). Недавно показано, что -катенин регулирует экспрессию ряда таламических генов (Wisniewska et al., 2012). В основном, это гены, кодирующие белки, отвечающие за возбудимость нейронов, например, потенциал-зависимые ионные каналы, рецепторы к нейромедиаторам, белки синаптических везикул и структурные белки. Таким образом, меняя проводимость мембраны для ионов Са2+, К+ и Cl-, -катенин может регулировать степень возбудимости нейронов таламуса (Wisniewska et al., 2012; Wisniewska, 2013).

Присутствие компонентов СП Wnt в разных областях мозга, а также его активное участие в нейрогенезе, обработке сенсорных сигналов и когнитивных функциях указывает на его фундаментальное значение в работе нервной системы (Oliva et al., 2013).

СП Wnt в регуляции поведения 1.3.

В последнее время активно изучается участие СП Wnt в процессах обучения и формирования памяти. Недавние исследования показали, что в патогенезе болезни Альцгеймера наряду с потерей памяти наблюдается нарушение регуляции СП Wnt/-катенин (Moon et al., 2004). При этом пока не ясно, каким образом СП Wnt вовлечен в механизмы обучения и памяти.

Стереотаксические инъекции антагониста Wnt Dkk-1 в базолатеральную миндалину выявили нарушение консолидации памяти без изменений кратковременной памяти. Интересно, что введение Wnt1 во время формирования памяти также препятствует ее консолидации. Кроме того, Wnt1 восстанавливает уровень мРНК Wnt1, сниженного после условной реакции страха. Вероятно, быстрое подавление экспрессии Wnt1 может быть критичным для консолидации памяти. Обучение способствует снижению экспрессии ряда генов семейства Wnt, в то время как в период консолидации памяти их количество нормализуется (Maguschak, Ressler, 2011). Известно также, что во время консолидации памяти в амигдале происходит кратковременный рост уровня мРНК -катенина, а его отсутствие вызывает нарушение процесса консолидации у взрослых мышей (Maguschak, Ressler, 2008).

С другой стороны, исследования пространственной памяти в водном лабиринте Морриса показали, что во время консолидации и реконсолидации памяти в гиппокампе обучаемых животных выборочно изменяется уровень Wnt7 и Wnt5a, но не Wnt3. Наиболее интенсивный рост уровня Wnt7 выявлен у крыс, обучавшихся в водном лабиринте со скрытой платформой, по сравнению с животными, обучавшимися с видимой платформой.

Запоминание при видимой платформе было лучше, однако обучение со скрытой платформой в большей степени сохранялось в памяти животных через 30 дней после обучения, что коррелировало с увеличенным уровнем экспрессии Wnt7 в гранулярных клетках зубчатой извилины (Tabatadze et al., 2012). Недавние исследования подтверждают, что активаторы канонического и неканонического СП Wnt WASP-1 и FOXY-5 соответственно усиливают кратковременное запоминание, улучшая эпизодическую память (Vargas et al., 2014).

В то же время локальное подавление экспрессии сигнального каскада Wnt в зубчатой извилине с помощью лентивирусной трансдукции приводило к снижению уровня нейрогенеза в указанной области и нарушениям в долговременной пространственной памяти, которые проявлялись в том, что крысы проводили меньше времени в целевой зоне водного лабиринта (Jessberger et al., 2009).

Активация СП Wnt/-катенин также необходима для гиппокампзависимой консолидации памяти в тесте на распознавание объекта.

Внутригиппокампальное введение Dkk-1, которое приводило к сильному снижению уровней Wnt-зависимых белков, таких, как -катенин, циклин D1, c-Myc и Wnt7, препятствовало узнаванию знакомого объекта (Fortress et al., 2013).

Недавние исследования механизмов воздействия СП на Wnt формирование памяти при гиппокамп-зависимой условной реакции избегания показали, что обучение вызывает экспрессию Wnt3a и активацию СП Wnt/-катенин и СП Wnt/Ca2+ в дорсальном гиппокампе. При этом СП Wnt/Ca2+ необходим для запоминания, а СП Wnt/ -катенин необходим для консолидации памяти (Xu et al., 2014).

Исследования влияния другого участника каскада Wnt APC на поведение мышей показали, что гетерозиготные мутанты мышей (APC+/-) неспособны к выполнению задач, требующих участия рабочей памяти (Koshimizu et al., 2011). Мыши с нокаутом по гену APC демонстрировали аутичное поведение (стереотипии, снижение социальных интересов) наряду с увеличенным уровнем -катенина и уменьшенным уровнем пресенилина (Mohn et al., 2014).

Участие СП Wnt в патогенезе нейродегенеративных заболеваний и 1.4.

психических расстройств.

Нарушения в работе СП Wnt связывают не только с когнитивными нарушениями у животных, но и с распространенными неврологическими (аутизм, шизофрения, биполярное расстройство) и нейродегенеративными заболеваниями (болезнь Альцгеймера, болезнь Гентингтона и болезнь Паркинсона) (Anderton, 2000; Boonen et al., 2009; Clevers, Nusse, 2012; Blalock et al., 2004; Hooper et al., 2008; Vogt et al., 2011; De Ferrari, Moon, 2006). В таблице 1 проиллюстрирована вовлеченность молекул, связанных с СП Wnt, в патогенез ряда неврологических заболеваний.

Таблица 1. Изменения компонентов сигнального пути Wnt при неврологических патологиях

–  –  –

Белки семейства Wnt, компоненты каскада и его целевые белки давно рассматриваются как терапевтические мишени для лечения болезни Альцгеймера (De Ferrari, Inestrosa, 2000; Peineau et al., 2008). Болезнь Альцгеймера (БА) – нейродегенеративное заболевание, сопровождающееся прогрессирующим ухудшением когнитивных функций из-за повреждения синапсов и гибели нейронов в отдельных областях мозга (Mattson, 2004;

Walsh, Selkoe, 2004). Отличительными чертами БА являются внеклеточные сенильные бляшки, состоящие из А, и внутриклеточные нейрофибриллярные сплетения, состоящие из гиперфорсфорилированного тау-белка (Mayeux, Stern, 2012).

Киназа гликоген синтазы 3 (GSK3), часть комплекса деградации катенина в каноническом СП Wnt, играет важную роль в патогенезе БА и ряда других неврологических заболеваний, таких как биполярное расстройство, синдром Дауна и шизофрения (Jope, Johnson, 2004, Hooper et al., 2008; Григорьян, 2013). У трансгенных мышей оверэкспрессия GSK3 предотвращает индукцию ДП и нарушает пространственное обучение (Hernandez et al., 2002; Hooper et al., 2007; Peineau et al., 2008), а также вызывает гиперфосфорилирование тау, снижение -катенина в ядрах и нейродегенерацию (Lucas et al., 2001). Эти нарушения коррелируют с потерей памяти и увеличением уровня GSK3 в гиппокампах пациентов с БА (Blalock et al., 2004). GSK3 также может связываться с белком PS-1, участвующим в протеолитическом расщеплении предшественника -амилоидного пептида APP до А (Takashima et al., 1998), а в культурах нейронов токсичность, вызванная А, зависит от повышенной активности GSK3 (Takashima et al., 1993).

Активация СП блокирующая оказывает Wnt, GSK3, нейропротекторное действие в культурах нейронов гиппокампа и в трансгенной модели БА (in vivo) (Inestrosa et al., 2002; De Ferrari et al., 2003;

Alvarez et al., 2004). У пациентов с ранним развитием наследственной БА и мутациями PS-1 было обнаружено значительное уменьшение уровня катенина. Белок PS-1 образует комплекс с -катенином, аналогичный комплексу -катенина с GSK3 и APC (Zhang et al., 1998). Тот факт, что ингибирование СП Wnt/-катенин/TCF усиливает чувствительность к апоптозу, дает основание предположить, что если -катенин стабилизирован, а TCF активирован, то нейроны выживают (Oliva et al., 2013). В то же время, Li с соавторами (Li et al., 2007) показали, что гиперфосфорилирование тау, конкурентно ингибирующее фосфорилирование -катенина GSK3, защищает клетки от апоптоза.

Другая молекула, вовлеченная в патогенез болезни Альцгеймера, – белок Dkk-1, антагонист Wnt. Недавно было показано, что Dkk-1 может также обратимо снижать число синаптических белков и количество активных пресинаптических сайтов, уменьшая размеры пре- и постсинаптических зон.

Экспрессия Dkk-1 в мозге пациентов с БА увеличена по сравнению со здоровыми людьми (Caricasole et al., 2004). Антитела к Dkk-1 блокируют синаптическую недостаточность, индуцированную -амилоидом, а его экспрессия, увеличивающаяся с возрастом, приводит к снижению нейрогенеза в гиппокампе (Purro et al., 2012). Понижение уровня Dkk-1 в нейрональных предшественниках не только усиливает нейрогенез и TCF/LEF активность, но и устраняет или снижает когнитивные нарушения, связанные с запоминанием и консолидацией памяти (Seib et al., 2013).

Одно из самых распространённых хронических неврологических заболеваний человека – эпилепсия – проявляется в предрасположенности организма к внезапному возникновению судорог.

Электроэнцефалографические исследования выявили связь эпилептиформных изменений нейрональной активности с наследственной мутацией APP, сопутствующей БА (Palop, Mucke, 2009). У пациентов с гиппокампальным склерозом, характеризующимся височной эпилепсией, прогрессирующей гибелью нейронов и глиозом, была обнаружена ранняя экспрессия Dkk-1. Увеличение уровня Dkk-1 предшествует гибели нейронов и в обонятельной луковице, и в гиппокампе крыс, но способствует развитию судорог, индуцированных каинатом. Предварительная инъекция хлорида лития животным предотвращала прогрессирующую гибель нейронов, не влияя на развитие индуцированных каинатом судорог (Busceti et al., 2007).

Таким образом, гибель нейронов и судорожная активность, вероятно, имеют различные механизмы.

Приведенные данные дают основания предположить, что воздействие на компоненты сигнального пути Wnt может стать базой для разработки методов лечения деменций и нейродегенеративных заболеваний. Поэтому особенно важно понять, каким образом нарушения в работе каскада Wnt приводят неврологическим и нейродегенеративным патологиям. Возможным механизмом являются изменения в пластичности синаптических связей, такие как дисбаланс между возбуждением и торможением либо изменение эффективности синаптической передачи, которые могут вызывать целый каскад эффектов на уровне нейронных сетей, а также к клеточной дегенерации или смерти (Palop, Mucke, 2009; Penzes et al. 2013).

СП Wnt в регуляции пластичности синаптической передачи 1.5.

В последние десятилетия все больше данных свидетельствуют о том, что СП Wnt является важным участником процессов синаптической пластичности. Компоненты СП Wnt активно управляют разнообразными процессами, связанными с реализацей синаптической передачи и структурными изменениями в нейронах (Cerpa et al., 2011; Chen et al., 2006;

Yu, Malenka, 2003). Например, -катенин, один из основных компонентов СП Wnt, вовлечен в механизм изменений дендритной морфологии, вызванных электрической активностью. Yu и Malenka, используя раствор К+ как модель деполяризации, показали увеличение числа и длины дендритных ветвей в культурах гиппокампальных нейронов в зависимости от доступности катенина. Также в регуляции изменения дендритного роста, зависящего от деполяризации, задействована CaMKIV (Yu, Malenka, 2003; Redmond et al.

2002). Однако, в присутствии Dkk1 эффект высокого содержания К+ приводит к уменьшению дендритных ветвей. С использованием репортерной клеточной линии, в которой для детекции Wnt используется GFP, было показано, что деполяризация нейронов ведет к увеличению секреции Wnt в нейронах гиппокампа, но не в астроцитах (Yu, Malenka, 2003).

Нейронная активность, вызванная высокой концентрацией К+, последовательно активирует NMDA рецепторы, CaMKK, CaMKI, Ras, MEK/ERK и CREB-зависимую транскрипцию Wnt2. Кроме того, Wnt2 сам может стимулировать дендритное развитие (Wayman et al., 2006). Наоборот, ингибитор СП Wnt WIF, который предотвращает связывание Wnt с рецептором Fzd (Han, Lin, 2005), подавляет дендритное ветвление, вызванное высокой концентрацией К+. В то же время CaMKIV запускает каскад, активирующий CREB и созревание дендритов (Redmond et al. 2002).

Вероятно, длительная нейронная активность вызывает синтез Wnt для усиления клеточного ответа (Wayman et al., 2006).

Эффекты воздействия СП на синаптическую передачу Wnt проявляются и в электрофизиологических экспериментах. Так, на переживающих срезах гиппокампа показано, что добавление в инкубационный раствор Wnt-5a увеличивает амплитуду ВПСП, а также нейтрализует депрессию синаптической передачи, индуцированную амилоидом (Cerpa et al., 2010). Wnt5a также облегчает индукцию долговременной посттетанической потенциации (ДП) (Cerpa et al., 2011), которая представляет собой долговременное изменение эффективности синаптических связей и является общепринятой моделью для изучения процессов пластичности (Bliss, Lomo, 1973).

ДП может вызывать изменения в количестве мРНК белков СП Wnt таких, как Wnt3a, Fzd4, -катенин и Dvl3. ДП также способствует накоплению -катенина в ядре и активации целевых генов каскада, что подтверждает запуск каскада после тетанизации Wnt/-катенинового синаптического входа. Кроме того, тетанизация снижает количество Wnt3a в синапсах, но блокатор NMDA рецепторов APV нейтрализует этот эффект, что позволяет сделать вывод о необходимости активации NMDA рецепторов для высвобождения Wnt3a из синапса (Chen et al., 2006).

Недавние исследования продемонстрировали in vitro, что активаторы канонического и неканонического СП и Wnt WASP-1 FOXY-5 соответственно увеличивают ДП в срезах гиппокампа (Vargas et al., 2014).

Более того, WASP-1 оказывает нейропротекторный эффект, восстанавливая ДП после нарушений, вызванных A (Vargas et al., 2015).

На основании данных о роли СП Wnt в модуляции эффективности и перестройке синапсов в ответ на изменения активности работы нейронов (Cerpa et al., 2011; Chen et al., 2006; Wayman et al., 2006; Vargas et al., 2014;

Vargas et al., 2015) можно заключить, что СП Wnt является важным регулятором процессов синаптической пластичности.

Роль белков СП Wnt в пре- и постсинаптических процессах 1.6.

Лиганды Wnt способны управлять множеством структурных и фунциональных изменений пластичности зрелых синапсов, затрагивая как пре-, так и постсинаптические механизмы.

Показано, что Wnt7a, являющийся лигандом канонического пути Wnt, регулирует рост и ветвление аксонов (Lucas, Salinas, 1997; Hall et al., 2000).

Кроме того, Wnt7a участвует в формировании активных зон (Ahmad-Annuar et al., 2006; Cerpa et al., 2008; Davis et al., 2008), увеличивая кластеризацию синапсина I в синаптических везикулах (Hall et al., 2000). Wnt7a способен также вызывать кластеризацию синаптофизина, синаптотагмина и белка SVне влияя на кластеризацию постсинаптических белков (Cerpa et al., 2008).

Мыши с дефицитом Wnt7a характеризуются задержкой в развитии синапсов, что подтверждает гипотезу о модуляции им пресинаптического аппарата (Hall et al., 2000). Предполагается, что для нормальной скорости циркуляции синаптических везикул требуется не только лиганд Wnt7a, но и белок Dvl1, а недостаток обоих молекул значительно уменьшает частоту миниатюрных возбуждающих постсинаптических токов, что говорит о нарушении процесса выброса медиатора (Hall et al., 2000; Ahmad-Annuar et al., 2006). Более того, Wnt 7a увеличивает частоту возбуждающих постсинаптических токов и снижает коэффициент парной фасилитации (Cerpa et al., 2008), а также принимает участие в транспорте рецепторов по нервной терминали, увеличивая количество и размеры ко-кластеров пресинаптических 7никотиновых ацетилхолиновых рецепторов (7-nAChR) и взаимодействие с белком APC (Farias et al., 2007).

Одним из важнейших компонентов, воздействующим на возбуждающую синаптическую передачу является неканонический лиганд Wnt5a (Cerpa et al., 2010; Cerpa et al., 2011), модулирующий возбуждающие синаптические токи через NMDA рецепторы, активируя PKC и JNK. Кроме того, Wnt5a регулирует тормозные синапсы в гиппокампе, усиливая кластеризацию и встраивание в мембрану GABAA рецепторов и увеличивая тормозные токи при участии каскада Wnt/Ca2+/CaMKII (Cuitino et al., 2010).

Известно также, что Wnt5a участвует в морфогенезе дендритных шипиков, инициируя появление новых и увеличивая плотность и размеры уже существующих, что повышает эффективность глутаматергических синапсов в гиппокампе (Varela-Nallar et al., 2010). Wnt5a вызывает рост уровня кальция в культуре нейронов гиппокампа, что дает позволяет предположить активацию Wnt/Ca2+ каскада (Varela-Nallar et al., 2010) и быстрое фосфорилирование CaMKII (Farias et al., 2009). Wnt5a также модулирует постсинаптический белковый аппарат через активацию каскада Wnt/JNK, увеличивая кластеризацию PSD-95, но не влияя на общий уровень этого белка (Farias et al., 2009).

Таким образом, активация канонического пути лигандами Wnt3a, Wnt7a или Wnt7b усиливает синаптогенез посредством стабилизации катенина, тогда как лиганд Wnt5a, запускающий неканонический путь, негативно влияет на синаптогенез (Davis et al., 2008). Интересно, что наномолярные концентрации влияющего, прежде всего, на Wnt3a, циркуляцию и экзоцитоз синаптических везикул в синапсах гиппокампа, увеличивают также частоту миниатюрных возбуждающих постсинаптических токов, повышая приток Са2+, что еще раз подтверждает взаимодействие канонического и неканонического Wnt/ Са2 каскадов (Cerpa et al., 2008; Avila et al., 2010).

Заключение 1.7.

Из вышеизложенного следует, что СП Wnt имеет фундаментальное значение для работы нервной системы (Гурская и др., 2015). Изменения в работе СП Wnt связывают с различными неврологическими патологиями, такими как болезнь Альцгеймера, шизофрения, психические расстройства.

Активация СП Wnt оказывает нейропротекторное действие, восстанавливая синаптические повреждения и когнитивные нарушения. Таким образом, СП Wnt является перспективной мишенью для разработки методов лечения различных неврологических заболеваний. При изучении поведения животных получены данные об участии СП Wnt в процессах запоминания, связанных с гиппокампом и миндалиной. В настоящее время активно изучается роль СП Wnt в регуляции синаптической пластичности.

Обнаружено, что активация СП Wnt усиливает синаптическую пластичность и улучшает когнитивные функции в то время, как подавление СП Wnt приводит к нарушению механизмов пластичности и памяти.

Ранее для изучения влияния подавления и усиления СП Wnt на ДП в срезах гиппокампа использовали фармакологические ингибиторы и активаторы (Chen et al. 2006; Cerpa et al, 2011; Vargas et al, 2014; Vargas et al., 2015). Для исследований на основе более сложной, но более реалистичной модели синаптической пластичности - ДП in vivo - требуется обеспечение хронических изменений в СП с минимальным оперативным Wnt вмешательством. Таким условиям удовлетворил бы метод нокаута (нокина) генов, однако в силу огромной роли СП Wnt в эмбриогенезе и дифференцировке клеток животные с измененными генами Wnt имеют критические нарушения в развитии, не позволяющие изучать функции нервной системы (van Amerongen et al., 2006; Aoki et al., 2008).

В данной работе применен метод локального хронического изменения экспрессии генов Wnt в зрелом мозге – инъекции суспензий лентивирусных конструкций непосредственно в изучаемую структуру. Для изучения положительной модуляции СП Wnt был выбран лиганд канонического каскада Wnt3, который был ранее использован для изучения участия СП Wnt как в регуляции ДП in vitro (Chen et al., 2006), так и в нейрогенезе в зубчатой фасции гиппокампа (Lie et al., 2005). Для отрицательной модуляции применяли доминантно-негативную мутацию гена Wnt1, также ранее уже применявшуюся для изучения нейрогенеза в зубчатой фасции гиппокампа с помощью лентивирусной трансдукции (Lie et al., 2005; Jessberger et al., 2009).

Аномальный белок Wnt1 занимает рецепторы и корецепторы СП Wnt, не позволяя нормальным лигандам, в том числе Wnt3 (Lie et al., 2005), активировать каскад. В данной работе впервые метод лентивирусной трансдукции применяется для изучения регуляции ДП in vivo лигандами и компонентами СП Wnt.

Следует отметить, что большинство исследований, посвященных роли СП Wnt в регуляции синаптической пластичности, проведены in vitro. На уровне целого мозга изучалось лишь участие каскада Wnt в процессах обучения и формирования памяти. Поэтому целью данной работы было исследование in vivo регуляции синаптической пластичности путем лентивирусного подавления и усиления сигнального пути Wnt.

ГЛАВА 2. МЕТОДЫ ИССЛЕДОВАНИЯ

Схема эксперимента 2.1.

Исследование влияния СП Wnt на синаптическую пластичность проводилось на половозрелых самцах крыс линии Вистар весом 250-350 г, полученных из питомника лабораторных животных «Пущино». Общее число использованных в эксперименте животных составило 180 особей. Животных содержали в стандартных условиях вивария при 21 ± 1°С с 12-часовым циклом сна/бодрствования и свободным доступом к пище и воде. Все эксперименты проведены в соответствии с требованиями этической комиссии Института Высшей Нервной Деятельности и Нейрофизиологии РАН.

Для воздействия на СП Wnt животным инъецировали суспензии лентивирусных конструкций в область СА1 гиппокампа, что позволяло локально подавить либо усилить канонический СП Wnt. Животные были разделены на четыре группы: первая группа получала инъекцию лентивирусной конструкции, экспрессирующей доминантно-негативный Wnt1 (LV-dnWnt1) – белок Wnt1, не способный связываться с рецептором Fzd и, следовательно, запускать каскад Wnt; вторая группа получала инъекцию лентивирусной конструкции, оверэкспрессирующей Wnt3 (LVWnt3). Контрольные группы получали эквивалентные объемы лентивирусной конструкции, не несущей гена интереса и экспрессирующей только GFP, либо физиологического раствора (0.9% NaCl) для исключения влияния собственно лентивируса. Через 14 дней после инъекции проводили 3 вида исследований: электрофизиологический эксперимент in vivo, биохимический анализ гомогенатов гиппокампов и иммуногистохимический анализ срезов гиппокампов в области введения вируса.

Создание лентивирусных конструкций 2.2.

В данном исследовании использовали 3 лентивирусные конструкции:

LV-dnWnt1, экспрессирующая доминантно-негативный Wnt1, LV-Wnt3, экспрессирующая Wnt3, и контрольная LV-GFP, не несущая гена интереса.

Все лентивирусные конструкции были разработаны и изготовлены Сергеем Владимировичем Саложиным и лабораторией молекулярной нейробиологии ИВНД и НФ РАН (Саложин, Большаков, 2008; Тухбатова и др., 2011).

Клоны, кодирующие кДНК для мышиных Wnt1 и Wnt3, были получены из OpenBiosystems. Как dnWnt1, так и Wnt3 амплифицировали с пары праймеров, содержащих сайты на AgeI на 5 'и 3' концах, и клонировали в лентивирусный вектор PCSC-SP-PW-IRES-GFP, любезно предоставленный доктором Алоном Хеном. Для амплификации усеченного варианта Wnt1 использовали следующие праймеры: – m-dnWnt1-F 5'

CCGACCGGTCAGGCCATGGGGCTC и –

m-dnWnt1-R 5' CCGACCGGTTCAGCAGAAGTTGGGCGATTTC; для амплификации белка Wnt3 – праймеры: m-Wnt3-F 5’ – AGTGGATCCATGGAGCCCCACCTGCTC и m-Wnt3-R 5’ – AGTGGATCCCTACTTGCAGGTGTGCACA. Успешные клоны были проверены рестрикционным анализом и секвенированием. Для приготовления суспензии контрольного вируса использовали плазмиду p156RRLsinPPTCMVGFPPRE (p156), также предоставленную доктором Алоном Хеном.

Для производства вирусов использовали кальций - фосфатную трансфекцию HEK293T в 10 100 мм чашках Петри. Были использованы следующие плазмиды: 12 мкг pLenti, 7,8 мкг pMDL, 4.2 мкг pVSV-G, 3 мкг pRev. Два супернатанта собирали через 24 и 48 ч после трансфекции и концентрировали при 50000 g в CP80WX ультрацентрифуге. Осадок ресуспендировали в растворе OPTI-MEM, аликвотировали и хранили при -70 ° С. Титр вируса был проверен в серии разведений на HEK293T клетках (Тухбатова и др., 2011).

Инъекции лентивирусных конструкций 2.3.

Инъекции вирусных суспензий крысам осуществляли после наркотизации хлоралгидратом (0.4 г/кг, в/б).

Инъекцию суспензии, содержащей LV-dnWnt1 либо LV-Wnt3, в объеме 2 мкл проводили унилатерально в область СА1 правого гиппокампа крысы (координаты:

-2.5 a/p, -1.6 m/l, 3.3 d/v от брегмы (Paxinos, Watson, 2005). Контрольные животные получали эквивалентные объемы суспензии LV-GFP, либо эквивалентные объемы физиологического раствора. Введение вируса осуществляли шприцом Hamilton (USA), установленным стереотаксически в указанные координаты с помощью инфузора (Stoelting, USA) со скоростью

0.2 мкл/мин. Крысам давали 14 дней для восстановления после операции.

Электрофизиологическое исследование на наркотизированных2.4. животных in vivo

2.4.1. Вживление электродов Для нейрофизиологического исследования влияния лентивирусных конструкций на долговременную потенциацию (ДП) in vivo проводили хирургическую операцию. Животных наркотизировали уретаном (1.75 г/кг, в/б) и стереотаксически унилатерально вживляли биполярные электроды, скрученные из нихромовой проволоки в заводской изоляции диаметром 80 мкм для стимуляции и регистрации вызванных ответов. Вживление электродов производили по следующим координатам: коллатерали Шаффера

-3.0 a/p, -3.0 m/l, 3.0-3.4 d/v от брегмы; поле СА1 гиппокампа -2.7 a/p, -1.5 m/l, 2.2-2.8 d/v от брегмы (Paxinos, Watson, 2005). Электроды фиксировали на черепе с помощью быстро схватывающегося стоматологического пластика протакрил М.

2.4.2. Электрофизиологический эксперимент Электрофизиологическое исследование in vivo проводили сразу после вживления электродов. Коллатерали Шаффера стимулировали прямоугольными импульсами длительностью 50-100 мкс. Эффективность синаптической передачи оценивали, регистрируя фокальные возбуждающие постсинаптические потенциалы (фВПСП) в поле СА1 (парная стимуляция:

межстимульный интервал 30 мс, между парами стимулов интервал 20 с, интенсивность 100-400 мкА). Интенсивность парной стимуляции подбирали так, чтобы амплитуда фВПСП достигала 40-50% от максимальной.

После стабилизации ответов проводили запись базовой активности (60 минут). Для индукции долговременной потенциации использовали высокочастотную тетанизацию: 5 групп с промежутком 30с по 4 пачки, в каждой 5 стимулов с частотой 100Гц, между пачками 200мс. После тетанизации запись вели еще 180 минут.

2.4.3. Обработка результатов Для каждого животного среднее значение амплитуды фВПСП до тетанизации принимали за 100% и далее значения фВПСП после тетанизации считали относительно него. Все данные представлены в виде среднее значение ± SEM (стандартная ошибка среднего). Статистический анализ проводили с помощью программного обеспечения Statistica 10 (StatSoft, USA). Для оценки достоверности изменений использовали двухфакторный дисперсионный анализ (ANOVA) с повторными измерениями - метод с одним межгрупповым (введение вируса) и одним внутригрупповым (повторные изменения в ходе тестирования) факторами. Для внутригруппового сравнения использовали апостериорный метод наименьших значимых различий Фишера (Fisher's LSD post hoc test).

Различия считали значимыми при Изменения амплитуды p 0.05.

долговременной потенциации в 20, 60 и 180 минут анализировали с помощью t-критерия Стьюдента.

Коэффициент парной фасилитации (ПФ) определяли, как отношение второго вызванного фВПСП к первому. Его изменения на протяжении всего периода регистрации также оценивали с помощью двухфакторного дисперсионного анализа с повторными измерениями, сопровождающегося апостериорным методом наименьших значимых различий Фишера.

Значимость изменений усредненного по времени исходного коэффициента ПФ (до тетанизации) определяли с помощью непараметрического критерия Манна-Уитни. Для оценки зависимости между усредненной амплитудой ДП в первые 40 минут после тетанизации от исходного коэффициента ПФ вычисляли уравнения соответствующих линий регрессии и анализировали коэффициенты корреляции Пирсона.

Биохимический анализ изменений СП Wnt в гиппокампе 2.5.

2.5.1. Изъятие гиппокампов Через 14 дней после инъекции у животных, наркотизированных уретаном (1.75 г/кг, в/б), изымали правые гиппокампы. Для биохимических исследований отбирали только дорсальную часть гиппокампа, в которую ранее проводили инъекцию.

2.5.2. Гомогенизация Полученные образцы гиппокампов гомогенизировали в буфере, содержавшем Tris/HCl pH 7.4 20мM, MgCl2 1.5мM, KCl 10мM, NaF 50мM, EDTA 1мM, NA3VO4 1мM, ФМСФ 1мM, сахарозы 0.25М, с помощью гомогенизатора Potter S (Braun Biotech, Germany). После гомогенизации образцы подвергали центрифугированию в течение 10 мин при 1000g, 4oC для получения грубой ядерной фракции. Супернатант повторно центрифугировали 20 мин при 16000g, 4oC и получали цитоплазматическую фракцию; осадок инкубировали с буфером, содержащим NP-40 (SigmaAldrich, USA), в течение 30 минут на льду. Далее этот растворенный осадок подвергали ультразвуковой обработке ультразвуковым дизинтегратором (MSE, UK) в течение 5 с для высвобождения содержимого ядер. После этого смесь центрифугировали 20 мин при 16000g, 4oC для получения ядерной фракции. Образцы хранили при температуре -80°C до использования.

2.5.3. Оценка количества белка Для оценки количества белка полученные пробы разводили в воде в концентрации 1:14 (5µл пробы, 70µл дистиллята) и добавляли к ним Кумасси (10µл разведенной пробы, 300µл Кумасси). Количество белка в пробе определяли на спектрофотометре Wallac Victor (USA) методом Брэдфорда. В среднем пробы содержали 3-4 мг/мл белка. На форез наносили пробу в объеме, содержащем 50 мкг белка.

2.5.4. Электрофорез белков в полиакриламидном геле Для нанесения на электрофорез пробы цитоплазматической фракции разбавляли в концентрации 4:1 пятикратным буфером, содержащим додецилсульфат натрия (SDS, Acros Organics, Belgium), и нагревали 5 минут при 100oC. Белки массой от 25 до 130 кД разделяли с помощью электрофореза с 12% полиакриламидным гелем (источник питания PowerPac HC, 90 мин: 30 мин 200В, 60мин 150В, Bio-Rad, USA) и переносили на PVDF мембрану (Bio-Rad, USA, пора 0,2µм) с использованием системы Mini TransBlot Cell и источника питания PowerPac HC (Bio-Rad, USA).

2.5.5. Вестерн блоттинг Полученные блоты инкубировали в растворе для блокировки неспецифичных связываний (5% либо 1% молоко в TBS с 0,05 % либо 0,1% Tween 20), затем помещали на 24 часа при 4oC в раствор первичных антител.

Для оценки количества белков СП Wnt использовали следующие антитела:

поликлональные антитела кролика против Wnt1 (1:10000, Abcam, UK), моноклональные антитела кролика против Wnt3 (1:2000, Abcam, UK) моноклональные антитела мыши против GSK-3 (1:15000, BD Transduction Laboratories, USA), моноклональные антитела кролика против фосфо-GSK-3 (Ser 9) (1:2000, Cell Signaling Technology, USA), моноклональные антитела кролика против -катенина (1:2000, Cell Signaling Technology, USA), моноклональные антитела мыши против циклина D1 (1:2000, Cell Signaling Technology, USA), моноклональные антитела кролика против c-Myc (1:5000, Cell Signaling Technology, USA) и поликлональные антитела кролика против PSD-95 (1:2000, Cell Signaling Technology, USA). Далее блоты отмывали в растворе TBST (50 mM Tris, 150 mM NaCl, 0.05% либо 0.1% Tween 20) и инкубировали со вторичными антителами (антитела козы против кроличьих, либо антитела козы против мышиных соответственно испольуемым первичным, Bio-Rad, USA) в блокировочном растворе при комнатной температуре в течение 1 часа. Иммунореактивность была визуализирована с помощью хемолюминесцентного субстрата SuperSignal West Pico (Thermo Scientific, USA). Для нормировки все блоты стриппировали и окрашивали повторно антителами мыши против -тубулина (1:15000, Sigma-Aldrich, USA).

2.5.6. Иммуноферментный анализ (ИФА) Уровни белков -катенина, фосфо--катенина (Ser45), GSK-3 и фосфоGSK-3 (Ser9) в ядерной фракции измеряли с помощью ИФА.

Для оценки количеств белков -катенина и фосфо--катенина (Ser45) использовали наборы InstantOne ELISA (eBioscience, USA), а для белков GSK-3 и фосфо-GSK-3 (Ser9)- PathScan Sandwich (Cell Signaling Technology, USA). Все анализы производили в соответствии с инструкциями производителей наборов.

Для определения количеств белков -катенина и фосфо- -катенина (Ser45) гомогенизированные пробы добавляли в лунки, обработанные антителами к -катенину и фосфо--катенину (Ser45) соответственно. Для нормировки в отдельные лунки добавляли аналогичное количество контрольной смеси лизированных клеток. Далее во все лунки добавляли смесь первичных и вторичных антител и инкубировали в течение 1 часа при комнатной температуре, после чего 3 раза промывали буфером. Затем в каждую лунку добавляли детектирующий реагент для запуска реакции проявления. Через 20 минут реакцию прерывали с помощью останавливающего раствора и переносили планшет в спектрофотометр Wallac Victor. Измерение оптической плотности производили при 450 нм.

Для определения количеств белков GSK-3 и фосфо- GSK-3 (Ser9) гомогенизированные пробы добавляли в лунки, обработанные антителами против GSK-3 и фосфо- GSK-3 (Ser9) соответственно, и инкубировали в течение 2 часов при 37oC. Затем лунки промывали буфером 4 раза и инкубировали с первичными антителами 1 час, снова промывали 4 раза, инкубировали со вторичными антителами 30 минут и после еще 4 промывок добавляли TMB субстрат для запуска пероксидазной реакции. Через 10 минут реакцию останавливали с помощью останавливающего раствора и переносили планшет в спектрофотометр Wallac Victor. Измерение оптической плотности производили при 450 нм.

2.5.7. Обработка результатов.

Результаты вестерн блоттинга анализировали с помощью программы NIH ImageJ. В таблице значений в контрольных группах данные представлены в виде процентного отношения иммунореактивности искомого белка к нормировочному (среднее значение ± SEM), а на рисунках для удобства анализа - в процентах от среднего значения иммунореактивности в группе LV-GFP.

Результаты иммуноферментного анализа таблице значений в контрольных группах представлены в виде отношения оптической плотности к количеству белка в мг (среднее значение ± SEM), а на рисунках - в процентах от среднего значения в группе LV-GFP.

Для проведения статистического анализа использовали программное обеспечение Statistica 10.0 (StatSoft, USA). Предварительный анализ биохимических данных показал отклонения от нормального распределения, поэтому достоверность эффектов оценивали с помощью непараметрического критерия Манна-Уитни. Различия считали статистически значимыми при p0.05.

Определение киназной активности GSK-3.

2.6.

Активность GSK-3 определяли в иммунопреципитатах, полученных из гомогенатов гиппокампа. Для этого гиппокамп гомогенизировали в буфере RIPA, содержащем 20 мМ Tris-HCl, pH 7.4, 137 мМ NaCl, 1 мМ 10% глицерол, 1 мM Na3VO4, 1 мM EDTA, 20 mM NaF, фенилметилсульфонилфторида, 1% NP-40, и центрифугировали при 18000 g 20 мин при 40С. Полученный супернатант в объеме, содержащем 500 мкг общего белка, предварительно очищали от неспецифически сорбирующихся белков добавлением 20 мкл cуспензии Protein A/G UltraLink Resin (Thermo Scientific, USA) с последующей инкубацией в течение 60 мин при 40С.

Моноклональные антитела мыши против крысиной GSK-3 (1 µг, BD Transduction Laboratories, USA) предварительно сорбировали на cуспензии Protein A/G UltraLink Resin (30мкл) в буфере RIPA в течение 1 часа при комнатной температуре. К сорбированным антителам добавляли очищенный супернатант гиппокампа и инкубировали в течение 12-15 ч при 40С.

Активность иммунопреципитированной GSK-3 определяли в реакционном буфере для киназ (20 мМ HEPES, pH 7.4, 10 мМ MgCl2, 0.5 мМ EGTA, 1 мМ NaF, 1 мМ Na3VO4), содержащем 50 µM субстрата GS-2 и 10 µCi [32P] ATP в конечном объеме 50 µл. После 30 мин инкубации при 300С реакцию останавливали перенесением образцов на лёд, затем центрифугировали и 20 л смеси наносили на кружок фосфоцеллюлозной бумаги P81. Фильтры промывали 5 раз в 1% фосфорной кислоте, смачивали в ацетоне и высушивали. Включение P в субстрат GS-2 определяли, детектируя радиоактивность фильтров на сцинтилляционном счетчике 1414 Winspectral (Wallac Oy, Финляндия). Данные представлены в виде процентного отношения активности GSK-3 в опытных группах LV-dnWnt1 и LV-Wnt3 к контрольной группе LV-GFP. достоверность эффектов оценивали с помощью непараметрического критерия Манна-Уитни. Различия считали статистически значимыми при p0.05.

Оценка распространения лентивирусных конструкций в2.7. гиппокампе.

2.7.1. Изготовление срезов гиппокампа Для проверки распространения лентивирусных конструкций в гиппокампе проводили морфологический контроль: через 14 дней после инъекции вирусов животное, анестезированное уретаном (1.75 г/кг, в/б), подвергали транскардиальной перфузии 0.9% раствором NaCl, а затем 4% раствором параформальдегида (Sigma-Aldrich, USA) в фосфатно-солевом буфере (PBS, Biolot, Russia). Мозг извлекали и помещали раствор параформальдегида в PBS на 2 дня. Через 2 дня из полученного мозга изготовляли фронтальные срезы толщиной 50 мкм с помощью вибротома Leica VT 1200S (Germany).

2.7.2. Иммуногистохимический анализ Срезы отмывали от фиксирующего раствора 3 раза по 30 мин раствором 0.05% Tween 20 (Acros Organics, Belgium) на PBS, затем инкубировали в блокировочном растворе (5% нормальная сыворотка козы в PBS) в течение 1 ч, затем переносили в раствор первичных антител (1:500, антитела кролика против GFP, Invitrogen, USA) на 24 часа при 4oC; после отмывок срезы инкубировали при комнатной температуре в течение 1 ч в растворе вторичных флуоресцентных антител (1:500, антитела козы против кроличьих Alexa 488), разведенных в блокировочном растворе (1% нормальная козлиная сыворотка в PBS). Срезы переносили на покрытые желатином стекла и анализировали с помощью флуоресцентного микроскопа Leica DM6000B (Leica, Germany). Размер области заражения и точность ее локализации в гиппокампе оценивали визуально по свечению зеленого флуоресцентного белка.

ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

Распространение лентивирусной конструкции в гиппокампе и 3.1.

эффективность заражения.

Применение лентивирусной трансдукции в качестве методического приема для изменения экспрессии белков канонического сигнального пути предполагало необходимость оценки размеров области мозга, Wnt подвергнутой вирусному воздействию. Определение эффективности лентивирусной трансдукции имело принципиальное значение для трактовки полученных результатов. В данной работе для исследования роли СП Wnt в регуляции синаптической пластичности были использованы 3 лентивирусных конструкции: LV-dnWnt1, экспрессирующая доминантнонегативный Wnt1 – для подавления каскада (loss-of-function study); LV-Wnt3, оверэкспрессирующая Wnt3 – для его усиления (gain-of-function study); LVGFP – контрольная конструкция, не несущая гена интереса (Ivanova et al., 2017). Каждый из лентивирусных векторов содержал кассету IRES-GFP, обеспечивающую экспрессию GFP в клетках, зараженных любой из использованных в данной работе лентивирусных суспензий. Таким образом, критерием эффективности трансдукции являлась интенсивность свечения белка GFP.

Область заражения была определена с помощью метода флуоресцентного иммунохимического окрашивания. Результаты окрашивания антителами к GFP области СА1 гиппокампа через 14 дней после инъекции суспензии лентивирусной конструкции представлены на рисунке 2. Проведенное исследование на срезах мозга крыс показало, что объем заражения составлял около 1.5 мм3 (рис.2Б).

A Б

Рисунок 2. Заражение поля СА1 гиппокампа контрольной лентивирусной конструкцией.

А. Схема гиппокампа с указанием области заражения, представленной на рисунке Б (зеленый прямоугольник). Б. Изображение области СА1 гиппокампа, полученное на флуоресцентном микроскопе (10кратное увеличение) после иммуногистохимического окрашивания срезов гиппокампа антителами к GFP.

Конструкция LV-dnWnt1 содержит доминантно-негативную мутацию гена, кодирующего белок Wnt1 с делецией 71 аминокислотного остатка в карбокси-концевой части, и нарушает функции СП Wnt за счет связывания аномального белка с рецепторами и корецепторами нормальных лигандов Wnt, не влияя на уровень экспрессии нормального белка Wnt1 (Garcia-Castro et al., 2002; Hoppler, 1996). Полученные в данной работе результаты вестерн блоттинга подтвердили, что инъекция суспензии LV-dnWnt1 в область СА1 гиппокампа не меняет уровень экспрессии Wnt1 (120.2 ± 24.0% в группе LVdnWnt1 в сравнении с 100.0 ± 19.5% в группе LV-GFP; p=0.8, n=13/группу;

рис.3А). В то же время, как и ожидалось, инъекция суспензии LV-Wnt3 вызывала значительное повышение уровня экспрессии белка Wnt3 Wnt3 (1464.3 ± 210.7% в группе LV-Wnt3 в сравнении с 100.0 ± 47.1% в группе LVGFP; p0.01, n=8/группу; рис.3Б).

–  –  –

Рисунок 3. Уровни экспрессии белков Wnt1 (A) и Wnt3 (Б) через 14 дней после инъекции суспензий LV-dnWnt1 (A, n=13/группу) и LV-Wnt3(Б, n=8/группу) соответственно.

Результаты Вестерн блоттинга представлены в виде средних значений иммунореактивности, нормированных на -Тубулин, в процентах от среднего значения иммунореактивности в группе LV-GFP;

разброс данных показывает стандартную ошибку среднего. Достоверность отличий от значений в группе LV-GFP рассчитана по непараметрическому критерию Манна-Уитни для несвязанных массивов данных. Статистически значимые отличия при p0.01 отмечены #.

–  –  –

Рисунок 4. Примеры фВПСП, зарегистрированных в поле CA1 гиппокампа в ответ на парную стимуляцию коллатералей Шаффера до и после высокочастотной тетанизации в группах животных, получавших инъекции физраствора (Saline-синим цветом) либо суспензий лентивирусных конструкций (Здесь и далее LV-GFP - зеленым, LV-dnWnt1-красным и LVWnt3-оранжевым цветом).

3.2.1. Сравнение контрольных групп Для исключения возможного влияния лентивирусной конструкции на ДП in vivo были протестированы две контрольные группы животных. Одна группа получала инъекции контрольной лентивирусной конструкции, не содержащей вставки, меняющей экспрессию белков СП Wnt (LV-GFP, n=10), а другая – инъекции физиологического раствора (0.9% NaCl) (Saline, n=9).

Было показано, что амплитуды фВПСП поля CA1 гиппокампа у животных, получавших инъекции LV-GFP, не отличаются от таковых у животных группы Saline на протяжении всей записи (180 мин) (ANOVA: F(1,17)= 0.03, p = 0.9; n=9/10; рис. 5). Среднее значение амплитуды фВПСП после тетанизации в группе LV-GFP составило 144.5±7.6%, а в группе Saline – 142.5±8.0% (рис. 5).

–  –  –

Рисунок 5. Долговременная потенциация in vivo в поле CA1 гиппокампа при стимуляции коллатералей Шаффера в двух контрольных группах животных: LV-GFP и Saline.

Динамика изменения амплитуд фВПСП в течение 60 минут до и 180 минут после высокочастотной тетанизации.

Здесь и далее изменения показаны по отношению к базовому уровню показателей до тетанизации, принятому за 100% для каждой группы животных; для каждого момента времени представлена усредненная амплитуда фВПСП ± стандартная ошибка среднего.

Статистический анализ не выявил достоверных различий между контрольными группами, что позволяет предположить отсутствие значимого влияния лентивирусной трансдукции на ДП in vivo и в рамках данной модели сравнивать экспериментальные группы только с одной из контрольных – группой LV-GFP.

3.2.2. Динамика изменения долговременной потенциации in vivo в результате хронического подавления СП Wnt.

В первой серии экспериментов исследовали роль СП Wnt в индукции и поддержании ДП in vivo с помощью конструкции LV-dnWnt1, подавляющей его работу.

LV-dnWnt1 вызывала достоверное снижение амплитуды ДП по сравнению с LV-GFP (ANOVA: F (1,17) =7.4119, p0.05, n=9-10) на протяжении всего времени записи (180 мин). Среднее значение амплитуды фВПСП после тетанизации составило 117.2 ± 7.3 %, что значительно меньше среднего значения амплитуды после тетанизации в контрольной группе (144.7 ± 6.9%). Апостериорный анализ методом наименьших значимых различий выявил наиболее выраженные статистические отличия с 10-й по 130-ю минуты регистрации после тетанизации (рис.6).

–  –  –

Рисунок 6. Долговременная потенциация in vivo в условиях хронического подавления СП Wnt.

Динамика изменения амплитуд фВПСП в течение 60 минут до и 180 минут после высокочастотной тетанизации. Достоверные отличия значений в группе LV-dnWnt1 от значений в группе LV-GFP при p0.05 отмечены * (Дисперсионный анализ с повторными измерениями и апостериорный анализ методом наименьших значимых различий).

Усредненные амплитуды ДП в 20-ю и 60-ю минуты записи после тетанизации в группе LV-dnWnt1 (113.6 ± 4.2% и 115.6 ± 3.5% соответственно) были значительно снижены относительно таковых в группе LV-GFP (139.1 ± 3.8% и 148.7 ± 7.7% соответственно; p0.01, t-критерий Стьюдента; рис.7). Однако к 180-й минуте различия потеряли статистическую значимость (121.0 ± 6.1% в группе LV-dnWnt1 и 140.9 ± 14.0% в группе LV-GFP; p=0.25; рис.7), что говорит о возможности восстановления амплитуды ДП до прежнего уровня в дальнейшем.

–  –  –

Рисунок 7. Долговременная потенциация in vivo в условиях хронического подавления СП Wnt через 20, 60 и 180 минут после тетанизации.

Достоверные отличия значений в группе LV-dnWnt1 от значений в группе LVGFP при p0.01 отмечены # (t-критерий Стьюдента).

3.2.3. Динамика изменения долговременной потенциации in vivo в результате хронического усиления СП Wnt.

Вторая серия экспериментов была посвящена исследованию влияния оверэкспрессии белка Wnt3 - лиганда канонического СП Wnt - на индукцию и поддержание ДП. Локальное увеличение экспрессии Wnt3 в гиппокампе было достигнуто с помощью инъекции суспензии конструкции LV-Wnt3.

вызывала кратковременное (80 минут) увеличение LV-dnWnt3 амплитуды ДП по сравнению с LV-GFP (ANOVA: F (1,17) =5.0797, p0.05, n=9-10, рис. 8). Средние значения амплитуд фВПСП после тетанизации составили 161.6 ± 5.5% и 144.4 ± 5.3% в группах LV-Wnt3 и LV-GFP соответственно. При этом апостериорный анализ методом наименьших значимых различий выявил наиболее значимые изменения лишь в первые 50 минут после тетанизации (рис. 8).

–  –  –

Рисунок 8. Долговременная потенциация in vivo на фоне хронической оверэкспрессии Wnt3.

Динамика изменения амплитуд фВПСП в течение 60 минут до и 180 минут после высокочастотной тетанизации. Достоверные отличия значений в группе LV-Wnt3 от значений в группе LV-GFP при p0.05 отмечены *, при p0.01 - # (Дисперсионный анализ с повторными измерениями и апостериорный анализ методом наименьших значимых различий).

Усредненная амплитуда ДП была достоверно повышена в группе LVWnt3 (166.8 ± 7.3%) относительно группы LV-GFP (139.1 ± 3.8%) в 20-ю минуту записи после тетанизации (p0.01, t-критерий Стьюдента; рис. 9), в то время как в 60-ю и 180-ю минуты значимых различий между группами уже не наблюдалось (155.6 ± 5.9% и 146.7 ± 4.6% соответственно в группе LVWnt3 по сравнению с 148.7 ± 7.7% и 140.9 ± 14.0% соответственно в группе LV-GFP; p=0.49 и 0.73 соответственно; рис. 9)

–  –  –

Рисунок 9. Долговременная потенциация in vivo на фоне хронической оверэкспрессии Wnt3 через 20, 60 и 180 минут после тетанизации.

Достоверные отличия значений в группе LV-Wnt3 от значений в группе LVGFP при p0.01 отмечены # (t-критерий Стьюдента).

3.2.4. Заключение Таким образом, в рамках модели ДП in vivo хроническое подавление СП приводило к долговременному нарушению синаптической Wnt пластичности, в то время как хроническая оверэкспрессия Wnt3 вызывала кратковременное улучшение ее характеристик, продолжавшееся 1 час после тетанизации, после чего амплитуда ДП возвращалась на уровень контроля.

Интересно, что и уменьшение амплитуды ДП через 3 часа после тетанизации становилось недостоверным, оставляя возможность для восстановления ДП до контрольного уровня.

Пресинаптические изменения в результате хронического 3.3.

подавления и усиления СП Wnt.

Для оценки вклада пресинаптического аппарата в реализацию наблюдаемых изменений в синаптической пластичности анализировали парную фасилитацию (ПФ) в поле СА1 гиппокампа при парной стимуляции.

Значение коэффициента ПФ определяли, как отношение амплитуды второго вызванного фВПСП к амплитуде первого (рис. 10).

–  –  –

1 мВ 5мс Рисунок 10. Определение коэффициента парной фасилитации на примере индивидуального фВПСП в поле СА1 гиппокампа при парной стимуляции коллатералей Шаффера.

3.3.1. Сравнение контрольных групп При анализе динамики изменения коэффициента ПФ в первую очередь сравнили значения в контрольных группах. Дисперсионный анализ не выявил достоверных различий между значениями в группе LV-GFP и в группе Saline ни после тетанизации (ANOVA: F(1,17) = 1.17, p=0.29, рис 11), ни до неё (исходный коэффициент фасилитации, ANOVA: F(1,15) = 0.01, p=0.91, рис 11).

–  –  –

Рисунок 11. Динамика изменения коэффициента ПФ в поле СА1 гиппокампа в течение 60 минут до и 180 минут после высокочастотной тетанизации через 14 дней после инъекции LV-GFP либо Saline 3.3.2. Динамика изменения коэффициента ПФ в результате лентивирусной трансдукции.

Значение коэффициента ПФ после тетанизации не отличалось от значений в группе LV-GFP и в экспериментальных группах: LV-dnWnt1 (ANOVA: F(1,15) = 1.47, p=0.24; рис. 12) и LV-Wnt3 (ANOVA: F(1,16) = 0.03, p=0.87; рис. 12). Средние значения коэффициента ПФ после тетанизации составили 1.22 ± 0.09 в группе LV-dnWnt1, 1.39 ± 0.08 в группе LV-Wnt3, 1.37 ± 0.07 в группе LV-GFP.

3.3.3. Изменения исходного коэффициента ПФ (до тетанизации) в результате лентивирусной трансдукции.

В то же время значения коэффициента ПФ до тетанизации (исходный коэффициент ПФ) в группе LV-dnWnt1 были значительно меньше таковых в группе LV-GFP (ANOVA: F(1,15) = 6.41, p0.05, рис. 12). В группе LV-Wnt3 дисперсионный анализ не выявил достоверных отличий от контрольной группы, однако следует отметить тенденцию к повышению исходного коэффициента ПФ в этой группе относительно LV-GFP (ANOVA: F(1,13) = 2.88, p=0.1, рис. 12).

–  –  –

1,8 1,6 1,4 ** * ** 1,2

–  –  –

Рисунок 12. Динамика изменения коэффициента ПФ в поле СА1 гиппокампа в течение 60 минут до и 180 минут после высокочастотной тетанизации через 14 дней после лентивирусной трансдукции. Достоверные отличия значений в группах LV-dnWnt1 и LV-Wnt3 от значений в группе LV-GFP при p0.05 отмечены * (Дисперсионный анализ с повторными измерениями и апостериорный анализ методом наименьших значимых различий).

Усреднённый по времени коэффициент ПФ до тетанизации в группе LV-dnWnt1 был также значительно ниже такового в группе LV-GFP (1.22 ±

0.09 и 1.67 ± 0.13 соответственно; p0.05; n=9/10, критерий Манни-Уитни;

рис. 13). Значение этого параметра в группе LV-Wnt3 (1.86 ± 0.11) достоверно не отличалось от контроля (p=0.3, критерий Манни-Уитни n=9/10; рис. 13), но, как и ожидалось, было значительно выше, чем в группе LV-dnWnt1 (p0.01; n=9/группу, критерий Манни-Уитни; рис. 13).

–  –  –

1,8 1,6 1,4 * 1,2 1,0

–  –  –

Рисунок 13. Усреднённые значения исходного коэффициента ПФ (до тетанизации) в поле СА1 гиппокампа через 14 дней после лентивирусной трансдукции. Достоверные отличия значений в группах LV-dnWnt1 (n=9) и LV-Wnt3 (n=9) от значений в группе LV-GFP (n=10) при p0.05 отмечены * (непараметрический критерий Манна-Уитни).

3.3.4. Зависимость амплитуды ДП от исходного коэффициента ПФ Наблюдаемые изменения ДП in vivo преимущественно относились к ее ранней фазе (около 1 ч), поэтому для определения пресинаптического вклада в реализацию механизмов полученных эффектов оценивали зависимость ДП в первые 40 минут после тетанизации от исходного коэффициента фасилитации.

В группе LV-GFP была обнаружена слабая корреляция между этими двумя параметрами (r = 0.62; p=0.06; n=10/группу; рис. 14Б). В группе LVWnt3 корреляция была сильнее (r = 0.78; p=0.01; n=9/группу; рис. 14Г). В группе LV-dnWnt1 корреляции не было выявлено (r = -0.01; p=0.97;

n=9/группу; рис. 14В). Интересно, что в группе Saline корреляция между ДП в первые 40 минут после тетанизации и исходным коэффициентом ПФ оказалось сильнее, чем даже в группе LV-Wnt3 (r = 0.85 p=0.003; n=9/группу;

рис. 14А).

Рисунок 14. Зависимость усредненной амплитуды фВПСП в первые 40 минут после тетанизации от исходного коэффициента ПФ в группах Saline (А, n=9), LV-GFP (Б, n=10), LV-dnWnt1 (В, n=9) и LV-Wnt3 (Г, n=9). Для каждой группы на рисунке представлены уравнения линии регрессии, коэффициенты корреляции (r) и значимость корреляции (p).

3.3.5. Заключение Полученные результаты подтверждают важную роль СП Wnt в работе пресинаптического аппарата. Отсутствие корреляции между амплитудой ДП и исходным коэффициентом ПФ, а также его снижение в группе LV-dnWnt1 позволяют предположить, что в основе наблюдаемого нарушения ДП in vivo лежит повреждение пресинаптических функций, в то время, как сильная корреляция в группе LV-Wnt3 предполагает улучшение пресинаптического аппарата.

Постсинаптические изменения в результате хронического 3.4.

подавления и усиления СП Wnt.

В качестве показателя постсинаптических изменений через 14 дней после лентивирусной трансдукции оценивали экспрессию белка постсинаптической плотности PSD-95. В группе LV-dnWnt1 уровень PSD-95 не отличался от контрольной группы (123.48 ± 14.42 % по сравнению с 100.00 ± 23.89 % в группе LV-GFP; p=0.3, n=9/группу; рис. 15А), однако в группе LV-Wnt3 он был значительно повышен (150.3 ± 17.1 % по сравнению с 100.0 ± 18.0% в группе LV-GFP; p0.05, n=7/ группу; рис. 15Б).

–  –  –

Изменение экспрессии белков СП Wnt в гомогенатах гиппокампа 3.5.

через 14 дней после лентивирусной трансдукции.

В целях детального изучения механизмов, лежащих в основе регуляции ДП in vivo посредством локального подавления и усиления канонического СП Wnt, был проведен биохимический анализ гомогенатов гиппокампа крыс, получавших инъекции суспензий конструкций LV-dnWnt1, LV-Wnt3, LVGFP и физиологического раствора (Saline). В цитозольной фракции гомогенатов гиппокампа методом вестерн блоттинга были определены уровни экспрессии белков каскада: Wnt1, Wnt3, -катенина, циклина D1, cMyc, GSK-3. В ядерной фракции с помощью иммуноферментного анализа (ИФА) были измерены уровни экспрессии -катенина и GSK-3.

3.5.1. Сравнение контрольных групп.

При биохимическом анализе контрольные группы LV-GFP и Saline измеряли параллельно с экспериментальной (LV-dnWnt1 или LV-Wnt3).

Эксперименты с LV-dnWnt1 и LV-Wnt3 методом вестерн блоттинга были разделены во времени, поэтому для оценки влияния собственно лентивирусной конструкции сравнивали пары контрольных групп в обеих сериях.

В таблице 2 приведены значения иммунореактивности белков СП Wnt в контрольных группах LV-GFP и Saline для серий экспериментов с LVdnWnt1 (А) и LV-Wnt3 (Б) в процентах от иммунореактивности контрольного белка -тубулина.

–  –  –

В случае ИФА измеряли параллельно все 4 группы (LV-dnWnt1, LVWnt3, LV-GFP и Saline). Результаты ИФА для контрольных групп, представленные в виде значений оптической плотности при 450 нм, нормированных на миллиграмм белка, приведены в таблице 3.

–  –  –

Анализируя значения в таблицах 2 и 3, следует отметить, что достоверное отличие между контрольными группами наблюдалось только в случае -катенина в ядерной фракции, что позволяет предположить отсутствие значимого влияния лентивирусной трансдукции на экспрессию остальных белков в обеих фракциях и при оценке их экспрессии сравнивать экспериментальные группы только с одной из контрольных – группой LVGFP. Поэтому далее данные биохимических тестов будут представлены в процентах от группы LV-GFP.

3.5.2. Изменения уровня -катенина в результате хронического подавления и усиления СП Wnt.

Оценку биохимических изменений в гиппокампе через 14 дней после лентивирусной трансдукции справедливо начать с центрального белка канонического каскада Wnt -катенина. Уровень его экспрессии в цитозольной фракции менялся в направлении, соответствующем направлению действия лентивирусной используемой конструкции. Так, в группе LV-dnWnt1 уровень экспрессии -катенина был значительно снижен относительно контрольной группы (49.2 ± 11.6% по сравнению с 100.0 ± 18.1% соответственно; p0.05, n=9/группу; рис. 16А), а в группе LV-Wnt3 – достоверно повышен (189.3 ± 30.3% по сравнению с 100.0 ± 28.1% соответственно; p0.05, n=10/ группу; рис. 16Б).

–  –  –

3.5.3. Изменения уровней Циклина D1 и c-Myc в результате хронического подавления и усиления СП Wnt.

Как было описано в главе 1 «Обзор литературы», при активации канонического каскада Wnt -катенин может перемещаться в ядро и, связываясь с транскрипционными факторами TCF/LEF, регулировать транскрипцию циклина D1 и c-Myc (He et al. 1998; Shtutman et al. 1999).

Логично предположить, что уменьшение и увеличение уровня экспрессии катенина может сопровождаться снижением и повышением соответственно уровней экспрессии циклина D1 и c-Myc. Тем не менее, уровень циклина D1 не был изменен в группе LV-dnWnt1 относительно контрольной (65.9 ± 14.9% по сравнению с 100.0 ± 23.0% соответственно; p=0.3, n=12/группу; рис.

17А), хотя в группе LV-Wnt3 был достоверно повышен (131.8 ± 15.7% по сравнению с 100.0 ± 5.6% соответственно; p0.05, n=14/группу; рис. 17Б).

При этом на уровень экспрессии c-Myc не повлияла ни конструкция LVdnWnt1 (p=0.2, n=12/группу; рис. 17В), ни LV-Wnt3 (p=0.5, n=12/группу; рис.

17Г).

–  –  –

Рисунок 17. Уровни экспрессии Циклина D1 (А, Б) и c-Myc (В, Г) через 14 дней после инъекций суспензий LV-dnWnt1 (A, n=12/группу; В, n=12/группу) и LV-Wnt3 (Б, n=14/группу; Г, n=12/группу) соответственно (результаты Вестерн блоттинга). Статистически значимые отличия при p0.05 отмечены * (непараметрический критерий Манна-Уитни).

3.5.4. Изменения уровня экспрессии и активности GSK-3 в результате хронического подавления и усиления СП Wnt.

Особое внимание было уделено изучению изменений уровня экспрессии и активности GSK-3, так как ее вовлеченность в процессы синаптической пластичности широко освещена в литературе последних лет (Zhu et al. 2007; Hooper et al. 2007; Chew et al. 2015).

Уровень экспрессии GSK-3 не отличался от контроля ни в группе LVdnWnt1 (p=0.5, n=10/группу; рис. 18А), ни в группе LV-Wnt3 (p=0.6, рис. 18Б). Однако, вопреки ожиданиям, уровень n=13/группу;

фосфорилированной по 9 серину формы GSK-3 (фосфо-GSK-3) был значительно снижен как в группе LV-dnWnt1 (58.9 ± 11.8% по сравнению с 100.0 ± 8.4% в контрольной группе; p=0.01, n=9/группу; рис. 18В), так и в группе LV-Wnt3 (76.2 ± 13.4% по сравнению с 100.0 ± 12.5% в контрольной группе; p0.05, n=14/группу; рис. 18Г).

–  –  –

3.5.5. Изменения уровней экспрессии -катенина, GSK-3 и их фосфорилированных форм в ядерных фракциях гомогенатов гиппокампа.

Поскольку белки GSK-3 и -катенин обладают разными функциями в ядре клетки и в цитозоле (Everly et al., 2004; Wisniewska et al., 2010), уровни их экспрессии были измерены дополнительно в ядерной фракции гомогенатов гиппокампа с помощью ИФА.

Как было отмечено выше (раздел 3.5.1.), в ядерной фракции уровень экспрессии -катенина в группе Saline значительно отличался от такового в группе (Таблица 3), поэтому при обработке результатов LV-GFP экспериментальные группы сравнивали с обеими контрольными. Однако ни в группе LV-dnWnt1, ни в группе LV-Wnt3 не было выявлено достоверных изменений этого показателя ни от значений в группе LV-GFP, ни от значений в группе Saline. Значения уровня экспрессии -катенина в ядерной фракции гомогенатов гиппокампа составили 101.23 ± 21.57 % в группе LV-dnWnt1 по сравнению с 100.00 ± 5.27 % в группе LV-GFP (p=1.0), и с 138.55 ± 15.05 % в группе Saline (p=0.14); 121.87 ± 6.71 % в группе LV-Wnt3 по сравнению с 100.00 ± 5.27 % в группе LV-GFP (p=0.1), и с 138.55 ± 15.05 % в группе Saline (p=0.5), n=5/группу (рис. 20А).

Также с помощью ИФА в ядерной фракции был измерен уровень катенина, фосфорилированного по серину 45 (фосфо--катенина), сайту фосфорилирования CK-1, предшествующего фосфорилированию GSK-3 (Liu et al., 2002). Уровень фосфо--катенина в ядерной фракции в группе LVdnWnt1 был достоверно снижен относительно значений в группе, получавшей инъекции LV-GFP (77.48 ± 4.84 % по сравнению с 100.00 ± 7.56 % соответственно; p0.05, n=7 в группе LV-dnWnt1, n=10 в группе LV-GFP;

рис. 20Б). В группе LV-Wnt3 статистически значимых отличий от контроля обнаружено не было (103.20 ± 10.86 % по сравнению с 100.00 ± 7.56 % соответственно; p=0.8, n=9 в группе LV-Wnt3, n=10 в группе LV-GFP; рис.

20Б).

А Б

–  –  –

Рисунок 20. Уровни экспрессии -катенина (А) и его фосфорилированной по 45 серину формы (Б) в ядерной фракции гомогената гиппокампа через 14 дней после инъекций суспензий LV-dnWnt1 (А, n=5; Б, n=7), LV-Wnt3 (А, n=5;

Б, n=9), LV-GFP (А, n=5; Б, n=10) и физиологического раствора (Saline, n=5). Здесь и далее результаты ИФА представлены в виде средних значений оптической плотности при 450 нм, нормированных на миллиграмм белка, в процентах от среднего значения в группе LV-GFP. Статистически значимые отличия от значений в группе LV-GFP при p0.05 отмечены * (непараметрический критерий Манна-Уитни).

–  –  –

Рисунок 21. Уровни экспрессии GSK-3 (А) и ее фосфорилированной по 9 серину формы (Б) в ядерной фракции гомогената гиппокампа через 14 дней после инъекций суспензий LV-dnWnt1 (А, n=8; Б, n=7), LV-Wnt3 (А, n=9; Б, n=10) и LV-GFP (А, n=6; Б, n=8) (результаты ИФА). Статистически значимые отличия от значений в группе LV-GFP при p0.05 отмечены * (непараметрический критерий Манна-Уитни).

–  –  –

каскада не произвело изменений ни в уровне экспрессии Циклина D1, ни в уровне экспрессии c-Myc.

ГЛАВА 4. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

С 1973 года долговременная потенциация (ДП) является одной из наиболее используемых моделей для изучения механизмов регуляции синаптической пластичности (Брагин, Виноградова, 1973; Bliss, Lomo, 1973;

Bliss, Collingridge, 1993). Феномен ДП представляет собой длительное увеличение эффективности синаптической передачи после кратковременного воздействия на синаптический проводящий путь, сопровождающееся многочисленными электрофизиологическими (Voronin, 1993; Voronin, Cherubini, 2003), биохимическими (Chen, Tonegawa, 1997; Силькис, 2000;

Кудряшов и др., 2003) и ультраструктурными изменениями (Ziv, Garner, 2001; Мошков, Павлик, 2004).

В настоящее время различают 3 фазы ДП:

кратковременная потенциация, продолжающаяся 30-45 минут сразу после тетанизации; ранняя ДП, начинающаяся через 30 минут или раньше и продолжающаяся 2-3 часа; поздняя ДП, длящаяся в течение многих часов (Bliss, Collingridge, 1993, Sweatt, 1999). На каждой стадии действуют различные молекулярные механизмы, включающие в себя взаимодействие множества сигнальных каскадов. Данное исследование посвящено участию сигнального пути Wnt в регуляции синаптической пластичности.

Пресинаптические механизмы нарушения ДП in vivo при 4.1.

хроническом подавлении СП Wnt Недавние исследования продемонстрировали in vitro нарушение ДП в срезах гиппокампа при фармакологическом ингибировании СП Wnt (Chen et al., 2006; Vargas et al., 2014; Vargas et al., 2015), в то время, как при его активации у контрольных мышей ДП увеличивалась, а в амилоидной модели болезни Альцгеймера ДП восстанавливалась до нормального уровня (Vargas et al., 2014; Vargas et al., 2015). Целью данного исследования было изучить возможность регуляции ДП посредством хронического in vivo лентивирусного подавления и усиления СП Wnt.

Как и ожидалось, генетическое подавление СП Wnt в области СА1 гиппокампа обеспечивало устойчивое подавление ДП in vivo на протяжении 2 часов. Через 3 часа после тетанизации амплитуда ДП не восстановилась до уровня контроля, но ее отличия от него стали незначительными. Таким образом, можно заключить, что лентивирусное подавление СП Wnt нарушает индукцию и экспрессию ранней фазы ДП in vivo с возможностью ее восстановления, в то время, как применение in vitro ингибитора СП Wnt (Wnt scavenger) и антител к Wnt3 влияет и на поддержание ДП (Chen et al., 2006;

Sweatt, 1999).

Экспрессия ДП в ранней фазе зависит как от пре-, так и от постсинаптических механизмов (Voronin, 1993; Bliss, Collingridge, 1993;

Schulz et al., 1994; Sweatt, 1999; Силькис, 2000). В данном исследовании в качестве показателя эффективности работы пресинаптического аппарата анализировали парную фасилитацию (ПФ) – увеличение второго «тестирующего» постсинаптического ответа после первого «обуславливающего» при парной стимуляции (Kleschevnikov et al., 1997). В нормальных условиях экспрессия ДП в первые 60 минут после тетанизации коррелирует со значениями исходного коэффициента ПФ (до тетанизации, Schulz et al., 1994; Kleschevnikov et al., 1997). Эта зависимость закономерна, так как пресинаптические перестройки связывают с изменением количества зон выброса медиатора либо вероятности выброса в каждой активной зоне (Voronin, 1993), что чрезвычайно важно для возникновения и поддержания ранней фазы ДП (Kleschevnikov et al., 1997). Явное отсутствие такой корреляции, а также значительное снижение исходного коэффициента ПФ в группе LV-dnWnt1 относительно контроля свидетельствует о нарушении работы пресинаптического аппарата, которое могло быть вызвано хроническим подавлением СП Wnt. Несмотря на то, что феномен парной фасилитации не может полностью прояснить этот вопрос, результаты хорошо согласуются с литературными данными об участии белков Wnt в пресинаптических процессах (Farias et al., 2007; Cerpa et al., 2008; VarelaNallar et al., 2009; Ahmad-Annuar et al., 2006).

Для анализа возможных постсинаптических изменений в области СА1 гиппокампа через 14 дней после лентивирусной трансдукции оценивали уровень экспрессии белка постсинаптической плотности (PSD-95). PSD-95 является строительным белком, поддерживающим встраивание глутаматных рецепторов в мембрану (Sheng, 2001). Ранее было показано, что ингибитор СП Wnt Dkk-1 вызывает снижение уровня PSD-95 в гиппокампе (Fortress et al., 2013), однако проведенный в данной работе биохимический анализ не выявил достоверных изменений в уровне PSD-95 при лентивирусном подавлении СП Wnt. Полученный результат не позволяет полностью исключить участие постсинаптических механизмов в эффектах действия LVdnWnt1, но подтверждает гипотезу о том, что в наблюдаемом нарушении ДП in vivo ключевую роль играют пресинаптические процессы.

Постсинаптические механизмы увеличения амплитуды ДП in vivo 4.2.

на фоне хронической оверэкспрессии Wnt3 Хроническая оверэкспрессия Wnt3 повлекла за собой кратковременное увеличение амплитуды ДП in vivo, сопровождающееся повышением уровня экспрессии В то же время недавние исследования PSD-95.

продемонстрировали, что хроническая активация СП Wnt действием WASP-1 (Wnt-activating small molecule), так же, как и кратковременное воздействие Wnt3 либо LiCl, увеличивает индукцию и поддержание ДП in vitro, не меняя уровень PSD-95 (Chen et al., 2006; Vargas et al., 2014). Для того, чтобы согласовать эти факты, следует отметить, что достоверные изменения ДП in vivo при лентивирусном усилении СП Wnt были выявлены лишь в течение первых 40 минут после тетанизации в отличие от длительных изменений ДП in vitro при фармакологической активации. Таким образом, хроническая оверэкспрессия Wnt3 влияла только на фазу кратковременной потенциации, зависящей преимущественно от количества рецепторов NMDA и AMPA на постсинаптической мембране (Bliss, Collingridge, 1993). Ранее в срезах гиппокампа было показано, что PSD-95, управляя встраиванием AMPAрецепторов, может искусственно симулировать ДП, предотвращая индукцию нормальной ДП (Stein et al., 2003; Ehrlich et al., 2004). И хотя PSD-95 не является необходимым для индукции и экспрессии ДП, его нокдаун ослабляет образование новых молчащих синапсов, содержащих только NMDA-рецепторы (Ehrlich et al., 2007). Вполне возможно, что увеличение уровня экспрессии PSD-95 за счет встраивания новых AMPA-рецепторов может уменьшать количество молчащих синапсов, облегчая тем самым индукцию ДП in vivo, однако это предположение требует дополнительного подтверждения.

Сильная корреляция между экспрессией ранней ДП in vivo и исходным коэффициентом ПФ косвенно свидетельствует об улучшении пресинаптических функций (Schulz et al., 1994; Kleschevnikov et al., 1997).

Тем не менее, отсутствие значимого увеличения исходного коэффициента ПФ относительно контроля подтверждает предположение о преимущественно постсинаптическом механизме наблюдаемого усиления ДП. Кроме того, в группе, получавшей инъекции физиологического раствора, корреляция между экспрессией ранней фазы ДП in vivo и исходным коэффициентом ПФ была даже сильнее, чем в группе, получавшей инъекции LV-Wnt3. Этот факт следует отметить как возможный побочный эффект действия лентивирусной конструкции per se, однако, к сожалению, в рамках данной выборки невозможно точно вычислить достоверность отличий друг от друга корреляций в группах Saline, LV-GFP и LV-Wnt3 и оценить нежелательные последствия действия лентивирусов.

Роль -катенина в реализации влияния СП Wnt на синаптическую 4.3.

пластичность Наблюдаемые пре- и постсинаптические изменения могут быть следствием повышения и понижения уровня -катенина в цитозоле на фоне действия лентивирусных конструкций. Ранее было показано, что в пресинапсе -катенин контролирует размеры и местоположение скопления везикул, в то время, как в постсинапсе он регулирует форму и размеры дендритных шипиков (Maguschak, Ressler, 2011). Также -катенин может служить связующим звеном во взаимодействии кадгеринов с актиновым цитоскелетом, тем самым регулируя работу кадгерин – содержащих адгезивных комплексов для формирования синапсов, поддержания синаптической структуры и ее трансформаций (Goda, 2002; Togashi et al., 2002; Chen et al., 2006; Кудряшова, 2009).

В отсутствие лигандов Wnt активен комплекс деградации -катенина, при этом сначала казеин киназа 1, а затем киназа гликоген синтазы -3 фосфорилируют -катенин, тем самым помечая его для (GSK-3) убиквитинирования и протеасомной деградации (Aberle et al., 1997;

MacDonald et al., 2009; Clevers, Nusse, 2012; Oliva et al., 2013). К сожалению, измерить уровень фосфорилированного -катенина в цитозоле – показатель степени деградации белка – не удалось. Вероятно, фосфорилирование катенина слишком быстро сменяется его убиквитинированием и протеасомной деградацией, что делает невозможным связывание с использованными антителами (Sadot et al., 2002).

Однако неожиданно были выявлены изменения в уровне фосфо-катенина фосфорилированного по серину 45, сайту (-катенина, фосфорилирования CK-1) в ядерной фракции. Результаты ИФА продемонстрировали в группе LV-dnWnt1 значительное снижение уровня фосфо--катенина, что свидетельствует в пользу гипотезы об отличии функций фосфорилирования -катенина по 45 серину в ядре от таковых в цитозоле (Maher et al., 2010). Эффектов воздействия конструкции LV-Wnt3 на фосфорилированный -катенин в ядерной фракции обнаружено не было.

Интересно, что уровень общего -катенина в ядерной фракции достоверно различался в двух контрольных группах. Этот факт также, как и в случае корреляции между экспрессией ранней фазы ДП in vivo и исходным коэффициентом ПФ (раздел 4.2), можно выделить, как побочный эффект действия лентивирусной конструкции Однако в обеих per se.

экспериментальных группах не было выявлено достоверных отличий уровня общего -катенина в ядерной фракции ни от одной из контрольных, поэтому в рамках данного исследования дальнейшее обсуждение этого вопроса не имеет смысла. Корреляция между экспрессией ранней фазы ДП in vivo и исходным коэффициентом ПФ и уровень общего -катенина в ядерной фракции – это все параметры, в которых были обнаружены значимые различия между контрольными группами. По остальным изучаемым параметрам побочных эффектов действия лентивирусной конструкции per se выявлено не было.

Участие целевых белков СП Wnt в реализации влияния 4.4.

подавления и усиления каскада на синаптическую пластичность Следует рассмотреть и другую гипотезу о механизмах влияния СП Wnt на синаптическую пластичность, касающуюся активации целевых белков каскада (Chen et al., 2006). В каноническом СП Wnt лиганды Wnt связываются с корецепторами Fz и LRP 5/6, что приводит к прерыванию работы комплекса деградации -катенина. Стабилизированный -катенин далее перемещается в ядро для регуляции экспрессии целевых генов каскада, в число которых входят Циклин D1 и c-Myc (Logan, Nusse, 2004; Toledo et al., 2008; Hodar et al., 2010; Stamos, Weis, 2013). Эти белки являются важными регуляторами плюрипотентности, метаболизма и клеточного цикла клеток предшественников (Amendola et al., 2009; Wey et al., 2010). Ранее применение ингибитора СП Wnt Dkk-1 в гиппокампе снижало уровень Циклина D1 через 4 часа после введения, а уровень c-Myc – уже через 5 минут (Fortress et al., 2013), однако лентивирусное подавление СП Wnt не повлияло ни на уровень Циклина D1, ни на уровень c-Myc. Кроме того, литературные данные свидетельствуют о повышении уровня экспрессии c-Myc (Vargas et al., 2014) и нескольких других целевых белков каскада (Chen et al., 2006) при фармакологической активации СП Wnt, в то время, как лентивирусная оверэкспрессия Wnt3 не повлияла на уровень c-Myc, но вызвала значительное увеличение уровня Циклина D1. Вероятно, изменения СП Wnt/-катенина, произведенные LV-dnWnt1, не затрагивают Wnt –зависимую транскрипцию генов. Тогда нарушения ДП in vivo на фоне действия LVdnWnt1 связаны не с изменением транскрипции целевых генов СП Wnt, а с увеличением либо уменьшением активности одного из непосредственных участников каскада. В случае LV-Wnt3 повышение уровня Циклина D1 также может быть следствием иных механизмов, которые будут обсуждаться в разделе 4.5.

Роль GSK-3 в регуляции синаптической пластичности 4.5.

посредством лентивирусного подавления и усиления СП Wnt Как было указано выше (разделы 4.1 и 4.2), лентивирусная трансдукция приводила к изменениям ДП in vivo преимущественно в ранней фазе, которая, как известно, сопровождается активацией множества протеинкиназ, таких как CaMKII, PKC, PKA, MAPK (Bliss, Collingridge, 1993, Sweatt, 1999).

Некоторые из них (PKC, PKA, MAPK) могут фосфорилировать GSK-3, одну из ключевых частей комплекса деградации -катенина, регулируя ее активность (Chen et al., 2000; Inestrosa et al., 2002 Peineau et al., 2008).

Литературные данные указывают на неоднозначность роли GSK-3 в синаптической пластичности. С одной стороны, ее активация или оверэкспрессия приводили к нарушениям индукции и поддержания ДП и дефициту пространственной памяти (Zhu et al., 2007; Hernandez et al., 2002;

Hooper et al., 2007), а фармакологическое подавление ингибирующего фосфорилирования GSK-3 с помощью TCS-183 блокировало ДП в срезах гиппокампа (Vargas et al., 2014). С другой стороны, лентивирусное подавление GSK-3 в зубчатой извилине гиппокампа вызывало дефицит контекстной памяти страха, хотя и увеличивало ДП (Chew et al., 2015). Также известно, что использование ингибитора лития, помимо GSK-3 положительного эффекта на синаптическую пластичность, повышает риск развития деменций (Dunn et al., 2005) и приводит к когнитивным нарушениям (Weingartner et al., 1985; Stip et al., 2000; Wingo et al., 2009).

Результаты, полученные в данном исследовании, подчеркивают неоднозначность функций уровень экспрессии ее

GSK-3:

фосфорилированной по ингибирующему сайту серину 9 формы (фосфо-GSKбыл снижен под действием обеих лентивирусных конструкций, а активность увеличена при хронической оверэкспрессии Wnt3. На первый взгляд может показаться, что результаты противоречат данным предыдущих исследований, использовавших фармакологический ингибитор Dkk-1 и активатор WASP-1: Dkk-1 снижал уровень фосфо-GSK-3 через 5 минут после введения, но увеличивал через 4 часа; применение WASP-1 также повышало уровень фосфо-GSK-3 (Fortress et al., 2013; Vargas et al., 2014). В случае Dkk-1 несоответствие объясняется кратковременностью его действия:

через 4 часа после введения имеют место восстановительные пост-эффекты, а не непосредственное влияние ингибирования. Так, хроническое лентивирусное подавление СП Wnt следует рассматривать как непрерывную последовательность кратковременных пятиминутных периодов ингибиторного действия. Противоречие между эффектами хронического введения WASP-1 и лентивирусной оверэкспрессии Wnt3 относится скорее к методическому несоответствию: Vargas и коллеги измеряли уровень фосфоGSK-3 после поведенческих тестов, которые сами по себе вызывают увеличение уровня фосфо-GSK-3 (Fortress et al., 2013; Vargas et al., 2014).

Рассматривая гипотезу об изменении активности GSK-3 как о механизме регуляции ДП in vivo с помощью СП Wnt, логично предположить, что однонаправленные изменения уровня фосфо-GSK-3 на фоне применения лентивирусных конструкций противоположного действия могут быть следствием нарушения хрупкого баланса между регулирующими активность GSK-3 протенкиназами. В рамках этой гипотезы ухудшение либо улучшение условий для возникновения и поддержания ДП зависит не от направления изменения активности GSK-3, а от субстрата, который она фосфорилирует. GSK-3 может фосфорилировать ряд субстратов, многие из которых вовлечены в синаптическую пластичность (Sutherland et al., 2011).

При этом некоторые из них влияют на нее положительно: индуцируемый при гипоксии фактор 1 (HIF 1), ассоциированный с микротрубочками белок 2c (MAP2C), транскрипционный фактор p53 (Corcoran et. al., 2013; Han et. al., 2014; Pustylnyak et. al., 2015), а другие – отрицательно: киназа фокальных контактов (FAK), глюкокортикоидный рецептор (GR), транскрипционный фактор c-Jun, ассоциированный с микротрубочками белок 1b (MAP1B), протеинфосфатаза 1, тау (Yang et al.,2003; Zervas et al., 2005; Genoux et al., 2011; Lee et al., 2011; Seo et al., 2012; Hu et al., 2015; Jing et al., 2015).

Главным недостатком этой гипотезы является вопрос, как именно происходит выбор субстрата в случае подавления и усиления СП Wnt, и он, бесспорно, требует дальнейшего исследования.

GSK-3 локализуется не только в цитозоле, но и в ядрах и митохондриях (Bijur et al., 2003). При этом функции GSK-3 в ядрах отличаются от таковых в цитозоле. Недавно было показано, что GSK-3, входя в ядро, может образовывать комплекс с -катенином, не фосфорилируя его, и таким образом подавлять -катенин/TCF – зависимую транскрипцию (Caspi et al., 2008). В данном исследовании лентивирусная трансдукция не повлияла на уровень общей GSK-3 в ядерной фракции ни в случае подавления, ни в случае усиления СП Wnt. Однако уровень фосфо- GSK-3 в ядерной фракции был достоверно понижен на фоне оверэкспрессии Wnt3, что, как уже было упомянуто (раздел 3.5.4), свидетельствует о повышении активности киназы (Jope et al., 2007). Интересно, что в ядре активная GSK-3 может фосфорилировать Циклин D1, способствуя его перераспределению из ядра в цитоплазму (Alt et al., 2000). Таким образом, наблюдаемое увеличение уровня Циклина D1 в цитозоле на фоне оверэкспрессии Wnt3 можно объяснить влиянием лентивирусной конструкции на уровень GSK-3 в ядре, а не на регуляцию транскрипции целевых генов СП Wnt (раздел 4.4). В пользу этого предположения свидетельствует также факт отсутствия изменений обоих параметров одновременно на фоне подавления СП Wnt.

Циклин D1 не является необходимым для индукции и поддержания ДП, хотя и может участвовать регуляции кратковременной пластичности (Li et al., 2007). Следовательно, повышение его уровня при оверэкспрессии Wnt3 не может быть решающим условием увеличения амплитуды ДП in vivo, однако может вносить свой вклад в облегчение ее индукции.

ЗАКЛЮЧЕНИЕ

В данном исследовании впервые продемонстрировано, что лентивирусное подавление СП Wnt приводит к нарушению ДП in vivo, в то время как лентивирусная оверэкспрессия Wnt3 вызывает кратковременное увеличение амплитуды ДП in vivo через 14 дней после лентивирусной трансдукции (Ivanova et al., 2017). Оба эффекта затрагивают раннюю фазу ДП и практически не влияют на ее поддержание в отличие от эффектов фармакологического ингибирования и активации каскада Wnt (Chen et al., 2006; Vargas et al., 2014).

Показано, что подавление ДП in vivo сопровождается нарушением работы пресинаптического аппарата, а увеличению амплитуды ДП сопутствует повышение уровня экспрессии PSD-95. Эти факты дают основание предположить, что в основе действия лентивирусной конструкции, подавляющей СП Wnt, лежат пресинаптические механизмы, тогда как лентивирусная оверэкспрессия Wnt3 вызывает облегчение индукции ДП in vivo с помощью постсинаптических перестроек.

Эффекты лентивирусной трансдукции также касались изменения экспрессии компонентов СП Wnt в области СА1 гиппокампа, но практически не затрагивали экспрессию его целевых генов. Уровень -катенина был понижен под действием лентивирусной конструкции, подавляющей СП Wnt, и повышен под действием лентивирусной конструкции, оверэкспрессиющей Wnt3. Уровень фосфо-GSK-3 был понижен независимо от направления лентивирусной трансдукции, что указывает на неоднозначность функций GSK-3 в реализации синаптической пластичности. Для наглядного обобщения приведенного выше обсуждения результатов на рис. 22 представлена предполагаемая схема механизмов влияния лентивирусных конструкций на ДП in vivo.

Рисунок 22. Предполагаемая схема механизмов влияния лентивирусных конструкций на ДП in vivo Данное исследование позволило на новом уровне оценить роль и механизмы участия сигнального пути Wnt в регуляции синаптической пластичности на модели ДП in vivo. Исследование in vivo эффектов воздействия сигнального пути Wnt на синаптическую пластичность чрезвычайно важно и с точки зрения практического применения. Так как белки семейства Wnt и компоненты каскада являются предполагаемыми мишенями для лечения нейродегенеративных и неврологических заболеваний, то подход, позволяющий локально хронически изменить их экспрессию в заданной структуре ЦНС, представляет несомненный интерес для клинических исследований.

ВЫВОДЫ

1. С помощью метода лентивирусной трансдукции локально в области СА1 гиппокампа крыс достигнуто хроническое подавление сигнального пути Wnt, не влияющее на экспрессию самого Wnt1, и хроническое усиление сигнального пути Wnt, сопровождающееся значительной оверэкспрессией белка Wnt3.

2. Хроническое подавление сигнального пути приводит к Wnt ослаблению долговременной потенциации in vivo в области СА1 гиппокампа при стимуляции коллатералей Шаффера, а его хроническое усиление - к облегчению ее индукции.

3. Угнетение синаптической пластичности, вызванное подавлением сигнального пути сопровождается нарушением работы Wnt, пресинаптического аппарата, в то время как оверэкспрессии Wnt3 приводит к постсинаптическим перестройкам.

4. Подавление сигнального пути Wnt с помощью лентивирусной трансдукции снижает уровень экспрессии -катенина в цитоплазме и фосфорилированного -катенина в ядре, но не влияет на экспрессию целевых белков каскада.

5. Усиление сигнального пути с помощью лентивирусной Wnt трансдукции повышает уровни экспрессии -катенина и Циклина D1 в цитоплазме и фосфорилированной киназы гликоген синтазы 3 в ядре.

6. Как усиление, так и подавление сигнального пути Wnt снижают уровень киназы гликоген синтазы 3, фосфорилированной по 9 серину.

БЛАГОДАРНОСТИ

Автор сердечно благодарит за неоценимую помощь и поддержку:

Владимира Александровича Маркевича;

Наталью Валерьевну Гуляеву;

Юлию Владимировну Добрякову;

Сергея Владимировича Саложина;

Виктора Александровича Аниола;

коллектив лаборатории Нейрофизиологии обучения;

коллектив лаборатории Функциональной биохимии нервной системы;

кафедру биофизики физического факультета МГУ;

Ингу Игоревну Полетаеву;

Галину Сергеевну Тарицыну;

Андрея Дмитриевича Иванова;

Татьяну и Ярослава Гурских

СПИСОК ЛИТЕРАТУРЫ

Аниол В.А., Тишкина А.О., Гуляева Н.В. Нейрогенез и нейровоспаление:

1.

роль белков семейства Wnt. Нейрохимия. 2016. 33(1):5-11.

Брагин А.Г., Виноградова О.С. Явление хронической потенциации в 2.

кортикальном афферентном входе пирамид поля СА3 гиппокампа.

Физиологические механизмы памяти. Пущино-на-Оке, издательство НЦБИ Пущино. 1973. 8-24.

Глушанкова Н.А. Цитоскелет и межклеточная адгезия. Вестник РОНЦ 3.

им. Н. Н. Блохина РАМН. 2003. 14(3): 50-58.

Григорьян Г.А. Роль гликоген синтазы киназы-3 в механизмах обучения 4.

и памяти. Журнал высшей нервной деятельности им. И.П. Павлова. 2013.

63(5): 507.

Гурская О. Я., Добрякова Ю. В., Маркевич В. А. Роль сигнального пути 5.

Wnt в регуляции работы мозга. Журнал высшей нервной деятельности. 2015.

65(4): 387–399.

Катанаев В.Л. Внутриклеточная передача сигнала от Wnt-лигандов и 6.

сопряженных с G-белками Frizzled-рецепторов. Биохимия. 2010. 75(12): 1642Кудряшов И.Е., Яковлев А.А., Кудряшова И.В., Гуляева Н.В.

7.

Ингибирование каспазы-3 блокирует длительную потенциацию в срезах гиппокампа. Журнал высшей нервной деятельности. 2003. 53(5): 537-540.

Кудряшова И.В. Протеолиз и протеолитические ферменты в 8.

структурной пластичности синапсов. Нейрохимия. 2009. 26(3): 191-201.

Куликова К.В., Кибардин А.В., Гнучев Н.В., Георгиев Г.П., Ларин С.С.

9.

Сигнальный путь Wnt и его значение для развития меланомы. Современные технологии в медицине. 2012. 3: 107-112.

Люлько А.В., Молчанов Р.Н., Шпонька И.С. Оценка экспрессии 10.

маркеров клеточного цикла и межклеточной адгезии у пациентов с поверхностным раком мочевого пузыря. Урология. 2012. 16(1): 52-60.

Маркевич В.А., Саложин С.В., Гуляева Н.В. Участие сигнального пути 11.

WNT в пластичности гиппокампа. Росс. Физиол. Журн. им. И.М. Сеченова 2012. 98(12): 1460-1470.

Москалев Е.А., Епринцев А.Т., Beier V., Никитин Е.Б., Воробьев И.Б., 12.

Hoheisel J.D. Эпигенетический анализ онкогенных сигнальных путей:

активация пути wnt в патогенезе хронического в-клеточного лимфолейкоза.

Организация и регуляция физиолого-биохимических процессов 2007. 9: 4-13.

Мошков Д.А., Павлик Л.Л. Ультраструктурные механизмы длительной 13.

потенциации синаптической передачи. Журнал высшей нервной деятельности. 2004. 54(1): 44-58.

Саложин С.В., Большаков А.П. Трансфекция клеток нервной системы.

14.

Журн. высш. нерв. деят. 2008. 58(6): 658-669.

Силькис И.Г. Унифицированный постсинаптический механизм 15.

пластичности в стриатуме, новой коре, гиппокампе и мозжечке". Росс.

физиол. журнал им. И.М. Сеченова. 2000. 86(5): 519-531.

Тухбатова Г.Р., Кулешова Е.П., Иванов А.Д., Степаничев М.Ю., 16.

Саложин С.В. Оптимизация метода получения лентивирусных частиц для трансдукции нейронов in vivo. Нейрохимия. 2011. 28(4): 333-339.

17. Ahmad-Annuar A., Ciani L., Simeonidis I., Herreros J., Fredj N.B., Rosso S.B., Hall A., Brickley S., Salinas P.C. Signaling across the synapse: a role for Wnt and disheveled in presynaptic assembly and neurotransmitter release. J. Cell Biol.

2006. 174: 127-139.

18. Alt J.R., Cleveland J.L., Hannink M., Diehl J.A. Phosphorylation-dependent regulation of cyclin D1 nuclear export and cyclin D1-dependent cellular transformation. Genes Dev. 2000. 14(24):3102-14.

19. Alvarez AR, Godoy JA, Mullendorff K, Olivares GH, Bronfman M, Inestrosa NC. Wnt-3a overcomes beta-amyloid toxicity in rat hippocampal neurons. Exp Cell Res. 2004. 297(1):186-96.

20. Amendola D., De Salvo M., Marchese R., Verga Falzacappa C., Stigliano A., Carico E., Brunetti E., Moscarini M., Bucci B. Myc down-regulation affects cyclin D1/cdk4 activity and induces apoptosis via Smac/Diablo pathway in an astrocytoma cell line. Cell Prolif. 2009. 42(1):94-109.

21. Anderton B.H., Dayanandan R., Killick R., Lovestone S. Does dysregulation of the Notch and wingless/Wnt pathways underlie the pathogenesis of Alzheimer's disease? Mol Med Today. 2000. 6(2):54-59.

22. Angers S., Moon R.T. Proximal events in Wnt signal transduction. Nat Rev Mol Cell Biol. 2009. 10: 468-477.

23. Aoki K., Taketo M.M. Tissue-specific transgenic, conditional knockout and knock-in mice of genes in the canonical Wnt signaling pathway. Methods Mol Biol. 2008. 468:307-331.

Arrzola M.S., Varela-Nallar L., Colombres M., Toledo E.M., Cruzat F., 24.

Pavez L., Assar R., Aravena A., Gonzlez M., Montecino M., Maass A., Martnez S., Inestrosa N.C. Calcium/calmodulin-dependent protein kinase type IV is a target gene of the Wnt/beta-catenin signaling pathway. J Cell Physiol. 2009. 221(3): 658Avila M.E., Sepulveda F.J., Burgos C.F., Moraga-Cid G., Parodi J., Moon,R.T., Aguayo L.G., Opazo C., De Ferrari G.V. Canonical Wnt3a modulates intracellular calcium and enhances excitatory neurotransmission in hippocampal neurons. J Biol Chem. 2010. 285: 18939-18947.

26. Bijur G.N., Jope R.S. Glycogen synthase kinase-3 beta is highly activated in nuclei and mitochondria. Neuroreport. 2003. 14(18):2415-9.

27. Bilic J., Huang Y.L., Davidson G., Zimmermann T., Cruciat C.M., Bienz M., Niehrs C. Wnt induces LRP6 signalosomes and promotes dishevelled-dependent LRP6 phosphorylation. Science. 2007. 316(5831): 1619-1622.

28. Blalock E.M., Geddes J.W., Chen K.C., Porter N.M., Markesbery W.R., Landfield P.W. Incipient Alzheimer’s disease: microarray correlation analyses reveal major transcriptional and tumor suppressor responses. Proc Natl Acad Sci U S A. 2004. 101: 2173-2178.

29. Bliss T.V., Collingridge G.L. A synaptic model of memory: long-term potentiation in the hippocampus. Nature. 1993. 361:31-9.

30. Bliss T.V., Lomo T. Long-lasting potentiation of synaptic transmission in the dentate area of the anaesthetized rabbit following stimulation of the perforant path.

J Physiol. 1973. 232(2): 331-56.

31. Boonen R.A., van Tijn P., Zivkovic D. Wnt signaling in Alzheimer's disease:

up or down, that is the question. Ageing Res Rev. 2009. 8:71-82.

32. Boutros M., Paricio N., Strutt D.I., Mlodzik M. Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell. 1998. 94: 109-118.

33. Busceti C.L., Biagioni F., Aronica E., Riozzi B., Storto M., Battaglia G., Giorgi F.S., Gradini R., Fornai F., Caricasole A., Nicoletti F., Bruno V. Induction of the Wnt inhibitor, Dickkopf-1, is associated with neurodegeneration related to temporal lobe epilepsy. Epilepsia. 2007. 48: 694-705.

34. Cadigan K.M., Nusse R. Wnt signaling: a common theme in animal development. Genes Dev. 1997. 11: 3286-3305.

35. Caricasole A., Copani A., Caraci F., Aronica E., Rozemuller A.J., Caruso A., Storto M., Gaviraghi G., Terstappen G.C., Nicoletti F. Induction of Dickkopfa negative modulator of the Wnt pathway, is associated with neuronal degeneration in Alzheimer’s brain. J Neurosci. 2004. 24: 6021-6027.

36. Caspi M., Zilberberg A., Eldar-Finkelman H., Rosin-Arbesfeld R. Nuclear GSK-3beta inhibits the canonical Wnt signalling pathway in a beta-catenin phosphorylation-independent manner. Oncogene. 2008. 27(25):3546-55.

37. Cerpa W., Farias G.G., Godoy J.A., Fuenzalida M., Bonansco C,. Inestrosa N.C. Wnt-5a occludes Abeta oligomer-induced depression of glutamatergic transmission in hippocampal neurons. Mol Neurodegener. 2010. 5: 3-15.

38. Cerpa W., Gambrill A., Inestrosa N.C., Barria A. Regulation of NMDAreceptor synaptic transmission by Wnt signaling. J Neurosci. 2011. 31: 9466-9471.

39. Cerpa W., Godoy J.A., Alfaro I., Farias G.G., Metcalfe M.J., Fuentealba R., Bonansco C., Inestrosa N.C. Wnt-7a modulates the synaptic vesicle cycle and synaptic transmission in hippocampal neurons. J Biol Chem. 2008. 283: 5918Chen C., Tonegawa S. Molecular genetic analysis of synaptic plasticity activity dependent neural development, learning and memory in the mammalian brain. Annu Rev Neurosci. 1997. 20: 157-184.

41. Chen J., Park C.S., Tang S.J. Activity-dependent synaptic Wnt release regulates hippocampal long term potentiation. J Biol Chem. 2006. 281: 11910Chew B., Ryu J.R., Ng T., Ma D., Dasgupta A., Neo S.H., Zhao J., Zhong Z., Bichler Z., Sajikumar S., Goh E.L. Lentiviral silencing of GSK-3 in adult dentate gyrus impairs contextual fear memory and synaptic plasticity. Front Behav Neurosci. 2015. 9:158.

43. Clevers H., Nusse R. Wnt/beta-catenin signaling and disease. Cell. 2012.

149: 1192–1205.

44. Corcoran A., Kunze R., Harney S.C., Breier G., Marti H.H., O'Connor J.J.

A role for prolyl hydroxylase domain proteins in hippocampal synaptic plasticity.

Hippocampus. 2013. 23(10):861-72.

45. Cuitino L., Godoy J.A., Farias G.G., Couve A., Bonansco C., Fuenzalida M., Inestrosa N.C. Wnt-5a modulates recycling of functional GABAA receptors on hippocampal neurons. J Neurosci. 2010. 30: 8411-8420.

46. Davis E.K., Zou Y., Ghosh A. Wnts acting through canonical and noncanonical signaling pathways exert opposite effects on hippocampal synapse formation. Neural Dev. 2008. 3: 32-48.

47. De A. Wnt/Ca2+ signaling pathway: a brief overview. Acta Biochim Biophys Sin (Shanghai). 2011. 43(10):745-56.

De Ferrari G.V., Chacn M.A., Barra M.I., Garrido J.L., Godoy J.A., 48.

Olivares G., Reyes A.E., Alvarez A., Bronfman M., Inestrosa N.C. Activation of Wnt signaling rescues neurodegeneration and behavioral impairments induced by beta-amyloid fibrils. Mol Psychiatry. 2003. 8(2):195-208.

49. De Ferrari G.V., Inestrosa N.C. Wnt signaling function in Alzheimer's disease. Brain Res Brain Res Rev. 2000. 33(1):1-12.

50. De Ferrari G.V., Moon R.T. The ups and downs of Wnt signaling in prevalent neurological disorders. Oncogene. 2006. 25:7545-7553.

51. Duman R.S., Monteggia L.M. A neurotrophic model for stress-related mood disorders. Biol Psychiatry. 2006. 59: 1116–1127.

52. Duman R.S., Voleti B. Signaling pathways underlying the pathophysiology and treatment of depression: novel mechanisms for rapid-acting agents. Trends Neurosci. 2012. 35(1):47-56.

53. Dunn N., Holmes C., Mullee M. Does lithium therapy protect against the onset of dementia? Alzheimer Dis Assoc Disord. 2005. 19: 20–22.

54. Ehrlich I., Klein M., Rumpel S., Malinow R. PSD-95 is required for activitydriven synapse stabilization. Proc Natl Acad Sci U S A. 2007. 104:4176-81.

55. Ehrlich I., Malinow R. Postsynaptic density 95 controls AMPA receptor incorporation during long-term potentiation and experience-driven synaptic plasticity. J Neurosci. 2004. 24:916-27.

56. Everly D.N. Jr., Kusano S., Raab-Traub N. Accumulation of cytoplasmic beta-catenin and nuclear glycogen synthase kinase 3beta in Epstein-Barr virusinfected cells. J Virol. 2004. 78(21):11648-11655.

57. Farias G.G., Alfaro I.E., Cerpa W., Grabowski C.P., Godoy J.A., Bonansco C., Inestrosa N.C. Wnt-5a/JNK signaling promotes the clustering of PSD-95 in hippocampal neurons. J Biol Chem. 2009. 284: 15857-15866.

58. Farias G.G., Valles A.S., Colombres M., Godoy J.A., Toledo E.M., Lukas R.J., Barrantes F.J., Inestrosa N.C. Wnt-7a induces presynaptic colocalization of alpha7-nicotinic acetylcholine receptors and adenomatous polyposis coli in hippocampal neurons. J Neurosci. 2007. 27: 5313-5325.

59. Fortress A.M., Schram S.L., Tuscher J.J., Frick K.M. Canonical Wnt signaling is necessary for object recognition memory consolidation. J Neurosci.

2013. 33: 12619-12626.

60. Garcia-Castro M.I., Marcelle C., Bronner-Fraser M. Ectodermal Wnt function as a neural crest inducer. Science. 2002. 297:848-851.

61. Gavin B.J., McMahon J.A., McMahon A.P. Expression of multiple novel Wnt-1/int-1-related genes during fetal and adult mouse development. Genes Dev.

1990. 4: 2319-2332.

62. Genoux D., Bezerra P., Montgomery J.M. Intra-spaced stimulation and protein phosphatase 1 dictate the direction of synaptic plasticity. Eur J Neurosci.

2011. 33(10):1761-70.

63. Goda Y. Cadherins communicate structural plasticity of presynaptic and postsynaptic terminals. Neuron. 2002. 35:1-3.

64. Grumolato L., Liu G., Mong P., Mudbhary R., Biswas R., Arroyave R., Vijayakumar S., Economides A.N., Aaronson S.A. Canonical and noncanonical Wnts use a common mechanism to activate completely unrelated coreceptors.

Genes Dev. 2010. 24: 2517-2530.

65. Hall A.C., Lucas F.R., Salinas P.C. Axonal remodeling and synaptic differentiation in the cerebellum is regulated by WNT-7a signaling. Cell 2000.

100: 525-535.

66. Han C., Lin X. Shifted from Wnt to Hedgehog signaling pathways. Mol Cell.

2005. 17: 321-322.

67. Han S.M., Wan H., Kudo G., Foltz W.D., Vines D.C., Green D.E., Zoerle T., Tariq A., Brathwaite S., D'Abbondanza J., Ai J., Macdonald R.L. Molecular alterations in the hippocampus after experimental subarachnoid hemorrhage. J Cereb Blood Flow Metab. 2014. Jan;34(1):108-17.

68. Hernandez F., Borrell J., Guaza C., Avila J., Lucas J.J. Spatial learning deficit in transgenic mice that conditionally overexpress GSK-3beta in thebrain but do not form tau filaments. J Neurochem. 2002. 83: 1529-1533.

Hooper C., Killick R., Lovestone S. The GSK3 hypothesis of Alzheimer’s 69.

disease. J Neurochem. 2008. 104: 1433-1439.

70. Hooper C., Markevich V., Plattner F., Killick R., Schofield E., Engel T., Hernandez F., Anderton B., Rosenblum K., Bliss T., Cooke S.F., Avila J., Lucas J.J., Giese K.P., Stephenson J., Lovestone S. Glycogen synthase kinase-3 inhibition is integral to long-term potentiation. Eur J Neurosci. 2007. 25: 81-86.

71. Hoppler S., Brown J.D., Moon R.T. Expression of a dominant-negative Wnt blocks induction of MyoD in Xenopus embryos. Genes Dev. 1996. 10:2805-2817.

72. Hu J., Huang H.Z., Wang X., Xie A.J., Wang X., Liu D., Wang J.Z., Zhu L.Q.

Activation of Glycogen Synthase Kinase-3 Mediates the Olfactory Deficit-Induced Hippocampal Impairments. Mol Neurobiol Dec. 2015. 52(3):1601-17.

Inestrosa N, De Ferrari GV, Garrido JL, Alvarez A, Olivares GH, Barra 73.

MI, Bronfman M, Chacn MA. Wnt signaling involvement in beta-amyloiddependent neurodegeneration. Neurochem Int. 2002. 41(5):341-4.

74. Ivanova O.Ya., Dobryakova Y.V., Salozhin S.V., Aniol V.A., Onufriev M.V., Gulyaeva N.V., Markevich V.A. Lentiviral modulation of Wnt/-catenin signaling affects in vivo LTP. Cell Mol Neurobiol. 2017. doi: 10.1007/s10571-016-0455-z.

75. Jessberger S., Clark R.E., Broadbent N.J., Clemenson G.D. Jr., Consiglio A., Lie D.C., Squire L.R., Gage F.H. Dentate gyrus-specific knockdown of adult neurogenesis impairs spatial and object recognition memory in adult rats. Learn Mem. 2009. 16(2):147-54.

76. Jing L., Duan T.T., Tian M., Yuan Q., Tan J.W., Zhu Y.Y., Ding Z.Y., Cao J., Yang Y.X., Zhang X., Mao R.R., Richter-Levin G., Zhou Q.X., Xu L. Despairassociated memory requires a slow-onset CA1 long-term potentiation with unique underlying mechanisms. Sci Rep. 2015. Oct 9;5:15000. doi: 10.1038/srep15000.

77. Jope R.S., Johnson G.V. The glamour and gloom of glycogen synthase kinase-3. Trends Biochem Sci. 2004. 29: 95-102.

Karlsson M., Mllegrd I., Stiernstedt G., Wretlind B. Comparison of 78.

Western blot and enzyme-linked immunosorbent assay for diagnosis of Lyme borreliosis. Eur J Clin Microbiol Infect Dis. 1989. 8(10):871-7.

79. Kleschevnikov A.M., Sokolov M.V., Kuhnt U., Dawe G.S., Stephenson J.D., Voronin L.L. Changes in paired-pulse facilitation correlate with induction of longterm potentiation in area CA1 of rat hippocampal slices. Neuroscience. 1997.

76:829-43.

80. Kohn A.D., Moon R.T. Wnt and calcium signaling: beta-catenin-independent pathways. Cell Calcium. 2005. 38: 439-446.

81. Koshimizu H., Fukui Y., Takao K., Ohira K., Tanda K., Nakanishi K., Toyama K, Oshima M., Taketo M.M., Miyakawa T. Adenomatous polyposis coli heterozygous knockout mice display hypoactivity and age-dependent working memory deficits. Front Behav Neurosci. 2011. 5:85-94.

Kumar D.U., Devaraj H. Expression of Wnt 3a, -catenin, cyclin D1 and 82.

PCNA in mouse dentate gyrus subgranular zone (SGZ): a possible role of Wnt pathway in SGZ neural stem cell proliferation. Folia Biol (Praha). 2012. 58(3):115Kusserow A., Pang K., Sturm C., Hrouda M., Lentfer J., Schmidt H.A., Technau U., von Haeseler A., Hobmayer B., Martindale M.Q., Holstein T.W.

Unexpected complexity of the Wnt gene family in a sea anemone. Nature. 2005.

433: 156-160.

84. Lee E.J., Son G.H., Chung S., Lee S., Kim J., Choi S., Kim K. Impairment of fear memory consolidation in maternally stressed male mouse offspring: evidence for nongenomic glucocorticoid action on the amygdala. J Neurosci. 2011.

31(19):7131-40.

85. Levchenko A, Davtian S, Freylichman O, Zagrivnaya M, Kostareva A, Malashichev Y. Beta-catenin in schizophrenia: Possibly deleterious novel mutation.

Psychiatry Res. 2015. 228(3):843-8.

86. Li C., Li X., Chen W., Yu S., Chen J., Wang H., Ruan D. The different roles of cyclinD1-CDK4 in STP and mGluR-LTD during the postnatal development in mice hippocampus area CA1. BMC Dev Biol. 2007. 7:57.

87. Li H.L., Wang H.H., Liu S.J., Deng Y.Q., Zhang Y.J., Tian Q., Wang X.C., Chen X.Q., Yang Y., Zhang J.Y., Wang Q., Xu H., Liao F.F., Wang J.Z.

Phosphorylation of tau antagonizes apoptosis by stabilizing beta-catenin, a mechanism involved in Alzheimer’s neurodegeneration. Proc Natl Acad Sci. U S A. 2007. 104: 3591-3596.

Lie DC, Colamarino SA, Song HJ, Dsir L, Mira H, Consiglio A, Lein ES, 88.

Jessberger S, Lansford H, Dearie AR, Gage FH. Wnt signalling regulates adult hippocampal neurogenesis. Nature. 2005. 437(7063):1370-5.

89. Liu C., Li Y., Semenov M., Han C., Baeg G.H., Tan Y., Zhang Z., Lin X., He X. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell. 2002.108(6):837-47.

90. Logan C.Y., Nusse R. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev. 2004. Biol. 20: 781-810.

91. Lu B. BDNF and activity-dependent synaptic modulation. Learn Mem. 2003.

10: 86-98.

92. Lucas F.R., Salinas P.C. WNT-7a induces axonal remodeling and increases synapsin I levels in cerebellar neurons. Dev Biol. 1997. 192: 31-44.

93. Lucas J.J., Hernandez F., Gomez-Ramos P., Moran M.A., Hen R., Avila J.

Decreased nuclear beta-catenin, tau hyperphosphorylation and neurodegeneration in GSK-3beta conditional transgenic mice. EMBO J. 2001. 20: 27-39.

94. MacDonald B.T., Tamai K., He X. Wnt/beta-catenin signaling: components, mechanisms and diseases. Dev Cell. 2009 17: 9-26.

95. Maguschak K.A., Ressler K.J. Beta-catenin is required for memory consolidation. Nat Neurosci. 2008. 11: 1319-1326.

96. Maguschak K.A., Ressler K.J. Wnt signaling in amygdala-dependent learning and memory. J Neurosci. 2011. 31: 13057-13067.

97. Maher M.T., Mo R., Flozak A.S., Peled O.N., Gottardi C.J. Beta-catenin phosphorylated at serine 45 is spatially uncoupled from beta-catenin phosphorylated in the GSK3 domain: implications for signaling. PloS One. 2010.

5:e10184.

Mattson M.P. Pathways towards and away from Alzheimer’s disease.

98.

Nature. 2004. 430: 631-639.

99. Mayeux R., Stern Y. Epidemiology of Alzheimer disease. ColdSpring Harb Perspect Med. 2012. 2(8): 1-18.

100. McMahon A.P., Moon R.T. Ectopic expression of the protooncogene int-1 in

Xenopus embryos leads to duplication of the embryonic axis. Cell. 1989. 58:

1075–1084.

101. Mohn J.L., Alexander J., Pirone A., Palka C.D., Lee S.Y, Mebane L., Haydon P.G., Jacob M.H. Adenomatous polyposis coli protein deletion leads to cognitive and autism-like disabilities. Mol Psychiatry. 2014. 19: 1133-1142.

102. Moon R.T., Kohn A.D., De Ferrari G.V., Kaykas A. WNT and beta-catenin signalling: diseases and therapies. Nat Rev Genet. 2004. 5: 691-701.

103. Nelson W.J., Nusse R. Convergence of Wnt, beta-catenin, and cadherin pathways. Science. 2004. 303: 1483-1487.

104. Niehrs C. On growth and form: a Cartesian coordinate system of Wnt and BMP signaling specifies bilaterian body axes. Development. 2010. 137: 845-857.

105. Nusse R., Brown A., Papkoff J., Scambler P., Shackleford G., McMahon A., Moon R., Varmus H. A new nomenclature for int-1 and related genes: the Wnt gene family. Cell. 1991. 64: 231.

106. Nusse R., Varmus H. Three decades of Wnts: a personal perspective on how a scientific field developed. EMBO J. 2012. 31: 2670-2684.

107. Nusse R., Varmus H.E. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell.

1982. 31: 99–109.

108. Nsslein-Volhard C., Wieschaus E. Mutations affecting segment number and polarity in Drosophila. Nature. 1980. 287: 795-801.

109. Nsslein-Volhard C., Wieschaus E. Mutations affecting segment number and polarity in Drosophila. Nature. 1980. 287: 795-801.

110. Oliva C.A., Vargas J.Y., Inestrosa N.C. Wnts in adult brain: from synaptic plasticity to cognitive deficiencies. Front Cell Neurosci. 2013b. 7:224.

111. Palop J.J., Mucke L. Epilepsy and cognitive impairments in Alzheimer disease. Arch Neurol. 2009. 66: 435-440.

112. Paxinos G., Watson C. The Rat Brain in Stereotaxic Coordinates. Elsevier:

Academic Press, 2005. ISBN: 0-12-088472-0

113. Pei J.J., Braak E., Braak H., Grundke-Iqbal I., Iqbal K., Winblad B., Cowburn R.F. Distribution of active glycogen synthase kinase 3beta (GSK-3beta) in brains staged for Alzheimer disease neurofibrillary changes. J Neuropathol Exp Neurol. 1999. 58(9):1010-9.

114. Peineau S., Bradley C., Taghibiglou C., Doherty A., Bortolotto Z.A., Wang Y.T., Collingridge G.L. The role of GSK-3 in synaptic plasticity. Br J Pharmacol.

2008. 153(Suppl 1): 428-437.

115. Penzes P., Buonanno A., Passafarro M., Sala C., Sweet R.A. Developmental vulnerability of synapses and circuits associated with neuropsychiatric disorders. J Neurochem. 2013. 126: 165-182.

116. Purro S.A., Dickins E.M., Salinas P.C. The secreted Wnt antagonist Dickkopf-1 is required for amyloid beta-mediated synaptic loss. J Neurosci. 2012.

32: 3492-3498.

117. Pustylnyak V.O., Lisachev P.D., Shtark M.B. Expression of p53 target genes in the early phase of long-term potentiation in the rat hippocampal CA1 area.

Neural Plast. 2015;2015:242158. doi: 10.1155/2015/242158. Epub 2015 Feb 12.

118. Redmond L., Kashani A.H., Ghosh A. Calcium regulation of dendritic

growth via CaM kinase IV and CREB-mediated transcription. Neuron2002. 34:

999–1010

119. Reya T., Clevers H. Wnt signaling in stem cells and cancer. Nature2005.

434: 843-850.

120. Rijsewijk F., Schuermann M., Wagenaar E., Parren P., Weigel D., Nusse R.

The Drosophila homolog of the mouse mammary oncogene int-1 is identical to the segment polarity gene wingless. Cell. 1987. 50: 649-657.

121. Sadot E., Conacci-Sorrell M., Zhurinsky J., Shnizer D., Lando Z., Zharhary D., Kam Z., Ben-Ze'ev A., Geiger B. Regulation of S33/S37 phosphorylated betacatenin in normal and transformed cells. J Cell Sci. 2002. 115:2771-2780.

122. Snchez B., Monten V., Reyes P.A., Espinoza B. Standardization of microenzyme-linked immunosorbent assay (ELISA) and Western blot for detection of Trypanosoma cruzi antibodies using extracts from Mexican strains as antigens.

Arch Med Res. 2001. 32(5):382-8.

123. Schambony A., Wedlich D. Wnt-5A/Ror2 regulate expression of XPAPC through an alternative noncanonical signaling pathway. Dev Cell. 2007. 12: 779Schulz P.E., Cook E.P., Johnston D. Changes in paired-pulse facilitation suggest presynaptic involvement in long-term potentiation. J Neurosci. 1994.

14:5325-37.

125. Seib D.R., Corsini N.S., Ellwanger K., Plaas C., Mateos A., Pitzer C., Niehrs C, Celikel T, Martin-Villalba A. Loss of Dickkopf-1 restores neurogenesis in old age and counteracts cognitive decline. Cell Stem Cell. 2013. 12: 204-214.

126. Seo J., Hong J., Lee S.J., Choi S.Y. c-Jun N-terminal phosphorylation is essential for hippocampal synaptic plasticity. Neurosci Lett. 2012. 531(1):14-9.

127. Sharma R.P., Chopra V.L. Effect of the Wingless (wg1) mutation on wing and haltere development in Drosophila melanogaster. Dev Biol. 1976. 48: 461-465.



Pages:   || 2 |
Похожие работы:

«159 СУМСЬКИЙ ІСТОРИКО-АРХІВНИЙ ЖУРНАЛ. №X-ХІ. 2010 ДУБРОВИНСКИЙ C.Б. К ИСТОРИИ СТАНОВЛЕНИЯ И РАЗВИТИЯ МИКРОБИОЛОГИИ И ЭПИДЕМИОЛОГИИ В СРЕДНЕЙ АЗИИ ПРОФЕССОР А.Д.ГРЕКОВ (1873-1957). ИЗ ВОСПОМИНАНИЙ СТАРОГО ЭПИДЕМИОЛОГА1 Впервые публикуется фрагмент из воспоминаний профессора Самуила Борисови...»

«АДМИНИСТРАЦИЯ АКСАЙСКОГО РАЙОНА ПОСТАНОВЛЕНИЕ № 12. 10. 2016 457 г. Аксай Об утверждении административного регламента по предоставлению муниципальной услуги "Выдача справки об отсутствии (наличии) задолженности по арендной плате за земельный участок" В соответствии с Земельным кодексом Российской Федерации, Федеральным закон...»

«Министерство образования Республики Беларусь Учреждение образования "Международный государственный экологический университет имени А. Д. Сахарова" А. С. Шиляев С. П. Кундас А. С. Стукин ФИЗИЧЕСКИЕ ОСНОВЫ ПРИМЕНЕ...»

«Ворошилова Татьяна Михайловна КЛИНИКО-ЛАБОРАТОРНАЯ ОЦЕНКА ВЛИЯНИЯ БИСФОСФОНАТОВ И АНТИСЕПТИКА НА РЕЗИСТЕНТНОСТЬ ГРАМОТРИЦАТЕЛЬНЫХ БАКТЕРИЙ К КАРБАПЕНЕМАМ 14.03.10 – клиническая лабораторная диагностика 03...»

«3. 2017 СОДЕРЖАНИЕ CONTENTS РАСТЕНИЕВОДСТВО PLANT RAISING Асланов Г. А., Новрузова Г. Х. Aslanov G. A., Novruzova G. H. Влияние удобрений на урожайность хлопчатника 2 Effect of fertilizers on cotton productivity. 2 Ерошенко Л. А., Бекенова Л. В., Кузнецова Н. А., Yeroshenko L. A., B...»

«Номер: KZ61VCY00072512 Дата: 15.07.2016 АЗАСТАН РЕСПУБЛИКАСЫ МИНИСТЕРСТВО ЭНЕРГЕТИКИ ЭНЕРГЕТИКА МИНИСТРЛІГІ РЕСПУБЛИКА КАЗАХСТАН МНАЙ-ГАЗ КЕШЕНДЕГІ КОМИТЕТ ЭКОЛОГИЧЕСКОГО ЭКОЛОГИЯЛЫ РЕТТЕУ, РЕГУЛИРОВАНИЯ, КОНТРОЛЯ И БАЫЛАУ ЖНЕ МЕМЛЕКЕТТІК ГОСУДАРСТВЕННОЙ ИНСПЕКЦИИ ИНСПЕКЦИЯ КОМИТЕТІ В НЕФТЕГАЗОВОМ КОМПЛЕКСЕ АТЫРАУ...»

«Динозавры: назад в прошлое, предсказывая будущее. Тема урока: Назад в прошлое, предсказывая будущее"Цели урока: Образовательные формировать представления детей о далеком прошлом Земли;пополнить знания учащихся об эпохе динозавров;уметь сравни...»

«Межгосударственная кластерная интеграция. Санкт-Петербургский Кластер Чистых технологий для городской среды. Interstate cluster integration. Saint-Petersburg Cleantech Cluster for urban environment. Миссия Кластера Mission of the Cluster Cделать Санк...»

«АДМИНИСТРАЦИЯ АКСАЙСКОГО РАЙОНА ПОСТАНОВЛЕНИЕ № 13. 10. 2016 461 г. Аксай Об утверждении административного регламента по предоставлению муниципальной услуги "Расторжение договора аренды, безвозмездного пользования земельным участком" В соответствии с Земельным кодексом Российской Федерации, Федеральным законом от 03.07.2016 № 334-ФЗ "О...»

«ПОЛИТБЮРО 2.0: реновация вместо демонтажа Август 2017 Перечень докладов о Политбюро 2.0 21.08.2012 Большое правительство Владимира Путина и "Политбюро 2.0" 21.01.2013 Политбюро 2.0 накануне перезагрузки элитных групп 22.05.2013 Год Правительства Дмитрия Медведева...»

«For Official Use ENV/EPOC/EAP/MIN(2004)2 Organisation de Coopration et de Dveloppement Economiques Organisation for Economic Co-operation and Development _ _ Russian Or. English ENVIRONMENT DIRECTORATE ENVIRONMENT POLICY COMMITTEE For Official Use ENV/EPOC/EAP/MIN(2004)2 TASK FORCE FOR THE IMPLEMENTATION OF THE...»

«Секция 11. Экология, безопасность и охрана труда на предприятии Но уже сейчас очевидно, что успешность прогнозов, получаемых на основе имитационных моделей, существенно будет зависеть от качества стат. анализа э...»

«Новикова Любовь Александровна СТРУКТУРА И ДИНАМИКА ТРАВЯНОЙ РАСТИТЕЛЬНОСТИ ЛЕСОСТЕПНОЙ ЗОНЫ НА ЗАПАДНЫХ СКЛОНАХ ПРИВОЛЖСКОЙ ВОЗВЫШЕННОСТИ И ПУТИ ЕЕ ОПТИМИЗАЦИИ 03.02.01 – ботаника Автореферат диссертации на соискание учёной степени доктора биологических наук Саратов – 2011 Работа выполнена в Федеральном государственном бюд...»

«РАСПРОСТРАНЕНИЕ ЖИВОРОДЯЩЕЙ ЯЩЕРИЦЫ НА ЮГЕ АРЕАЛА В ПОВОЛЖЬЕ Г.В. Епланова Институт экологии Волжского бассейна РАН, г. Тольятти eplanova_ievb@mail.ru Живородящая ящерица Zootoca vivipara (Lichtenstein, 1823) – вид с обширным транспалеарктическим ареалом. Она распространена в с...»

«Биология. 7 класс Пояснительная записка Рабочая программа составлена на основе Закона об образовании Российской Федерации от 29.12.1012 приказ №273/ФЗ, Федерального государственного образовательного стандарта основного общего образования, Федерального базисного учебного п...»

«Министерство образования и науки Российской Федерации ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ОБРАЗОВАНИЯ "САРАТОВСКИЙ НАЦИОНАЛЬНЫЙ ИССЛЕДОВАТЕЛЬСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИМЕНИ Н.Г. ЧЕРНЫШЕВСКОГО" Кафедра геоморфологии и геоэкологии Формирование геолого-геоморфологических понятий в школьных курсах...»

«НАЗАРЕНКО Александр Владимирович СИСТЕМА ПОВЫШЕНИЯ КАЧЕСТВА КОМПЕТЕНТНОСТНО-ОРИЕНТИРОВАННОГО ЭКОЛОГИЧЕСКОГО ПРОФЕССИОНАЛЬНОПЕДАГОГИЧЕСКОГО ОБРАЗОВАНИЯ 13.00.08 – Теория и методика профессионального образования ДИССЕРТАЦИЯ...»

«Министерство культуры Российской Федераци ФГБУК "Государственный историко-архитектурный и этнографический музей-заповедник „Кижи“" Карельский научный центр Российской академии наук Бюллетень экологических исследований на территории музея-заповедника "Кижи" 2013 год Петрозаводск Издательский центр музея-заповедника "Кижи" УДК 502.7 ББК 20.1 Б 98...»

«Всероссийская научно-практическая конференция "Экология и безопасность в техносфере: современные проблемы и пути решения" ванные системы по управлению пожарно-спасательными формированиями, прогнозированию опасных факторов и чре...»

«RU 2 378 624 C2 (19) (11) (13) РОССИЙСКАЯ ФЕДЕРАЦИЯ (51) МПК G01F 23/296 (2006.01) ФЕДЕРАЛЬНАЯ СЛУЖБА ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ, ПАТЕНТАМ И ТОВАРНЫМ ЗНАКАМ (12) ОПИСАНИЕ ИЗОБРЕТЕНИЯ К ПАТЕНТУ (21), (22) Заявка: 2008111535/28, 27.03.2008 (72) Автор(ы): Казинцев Владимир...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "ТЮМЕНСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ" Институт наук о Земле Кафедра физической географии и экологии Марьинских Дмитрий Мих...»

«Ученые записки Крымского федерального университета имени В. И. Вернадского Биология, химия. Том 2 (68). 2016. № 3. С. 28–35. УДК 581.14:661.162.66(635.656) ДЕЙСТВИЕ ПРЕПАРАТА ЦИРКОН НА РОСТ И РАЗВИТИЕ РАСТЕНИЙ КУКУРУЗЫ В УСЛОВИЯХ ОСМОТИЧЕСКОГО СТРЕССА Собчук Н. А., Чмел...»

«МБОУ "Анабарская улусная гимназия"ОБСУЖДЕНО СОГЛАСОВАНО УТВЕРЖДАЮ На заседание МО зам директора по УНР директор школы Естественно-математического цикла Герасимова Н.И. Матвеева В.А._ Торокова А.П._ "_"_2015 г "_...»

«Бакшеева Юлия Витальевна ИССЛЕДОВАНИЕ ПРОСТРАНСТВЕННО-ЧАСТОТНЫХ СВОЙСТВ СИГНАЛОВ В УЛЬТРАЗВУКОВЫХ СИСТЕМАХ ДИАГНОСТИКИ БИОЛОГИЧЕСКИХ ОБЪЕКТОВ Специальность: 05.13.01 "Системный ан...»

«Ученые записки Таврического национального университета им. В. И. Вернадского Серия "Биология, химия". Том 25 (64). 2012. № 4. С. 255-263. УДК 548.736+546.64+54.057 СИНТЕЗ И ИССЛЕДОВА...»

«УДК 544.6 ВЛАГОПЕРЕНОС В БИКОМПОНЕНТНЫХ КОНСЕРВАЦИОННЫХ МАТЕРИАЛАХ НА БАЗЕ НЕПОЛЯРНЫХ РАСТВОРИТЕЛЕЙ Н. Е. Беспалько Кафедра "Безопасность жизнедеятельности и военная подготовка", ФГБОУ ВПО "ТГТУ"; bgd@mail.nnn.tstu...»

«Ученые записки университета имени П.Ф. Лесгафта, № 9 (91) – 2012 год учебное пособие / Д.Н. Давиденко, А.И. Зорин, В.Е. Борилкевич ; отв. ред. Д.Н. Давиденко ; С.-Петерб. гос. ун-т. – СПб. : Изд-во СПб ГУ, 2001. – 208 с.3. Данилин, Д.А. Изучение индивидуальных особенностей студен...»

«03.06.01 Физика и астрономия Направления № Научное направление Коды по ГРНТИ научноисследовательс 29.35; 29.37; 29.19; Физика кой 29.33; 29.19 деятельности Университет, позиционируя себя на российском и Стратегия на...»








 
2017 www.kn.lib-i.ru - «Бесплатная электронная библиотека - различные ресурсы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.