WWW.KN.LIB-I.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Различные ресурсы
 

«КОНСТРУИРОВАНИЕ РЕКОМБИНАНТНЫХ АНТИГЕНОВ И ВЫЯВЛЕНИЕ ГЕНЕТИЧЕСКИХ МАРКЕРОВ ДЛЯ ДИАГНОСТИКИ ГЕРПЕСВИРУСНЫХ ИНФЕКЦИЙ ЧЕЛОВЕКА ...»

На правах рукописи

Суслопаров Михаил Александрович

КОНСТРУИРОВАНИЕ РЕКОМБИНАНТНЫХ АНТИГЕНОВ И

ВЫЯВЛЕНИЕ ГЕНЕТИЧЕСКИХ МАРКЕРОВ ДЛЯ ДИАГНОСТИКИ ГЕРПЕСВИРУСНЫХ ИНФЕКЦИЙ ЧЕЛОВЕКА

03.00.06 –вирусология

АВТОРЕФЕРАТ

на соискание ученой степени

доктора медицинских наук

Кольцово – 2008

Работа выполнена в Федеральном государственном учреждении науки Государственный научный центр вирусологии и биотехнологии «Вектор» Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Минздравсоцразвития России

Научный руководитель (или консультант)

Официальные оппоненты доктор биологических наук Беклемишев А. Б.

доктор биологических наук, профессор Рябчикова Е. И.

доктор медицинских наук, профессор Кожевников В. С.

Ведущая организация ГУ НИИ вирусологии им. Д.И. Ивановского (ГУ НИИВ) РАМН.

РАМН (Москва)

Защита состоится 26 сентября 2008 года в _____ часов на заседании диссертационного совета Д.208.020.01 при ФГУН «Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора по адресу:

ФГУН ГНЦ ВБ «Вектор» Роспотребнадзора, Кольцово Новосибирской области, 630559, тел. (8-383) 336-74-28.



С диссертацией можно ознакомиться в библиотеке ФГУН ГНЦ ВБ «Вектор»

Роспотребнадзора.

Автореферат разослан ____ ___________ 2008 г.

Ученый секретарь диссертационного совета Л.И.Карпенко

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность исследования Герпесвирусные инфекции занимают одно из первых мест по распространенности, сложности диагностики и лечения среди инфекционных заболеваний. Клинические симптомы этих инфекций перекрываются с множеством других заболеваний, поэтому большое значение придается разработке диагностических систем, позволяющих дифференцировать инфекционный агент с высокой степенью специфичности. Сложность иммунодиагностики герпесвирусных инфекций обусловлена так же значительным серологическим перекрестом не только внутри семейства, но и с другими вирусами.

Семейство Herpesviridae включает 8 видов герпесвирусов человека и состоит из трех подсемейств:

-, - и - herpesvirinae. Наиболее существенное социальное и эпидемиологическое значение имеют шесть агентов - вирусы простого герпеса 1 и 2-го типа (ВПГ-1 ВПГ-2); вирус ветряной оспы и опоясывающего лишая (ВВО); цитомегаловирус (ЦМВ); вирус герпеса человека 6-го типа (ВГЧ-6); и вирус Эпштейна-Барр (ВЭБ). Вирус герпеса человека 7-го типа (ВГЧ-7), и вирус саркомы Капоши или вирус герпеса человека 8-го типа (ВГЧ-8) открыты сравнительно недавно и этиопатогенетическое значение этих инфекций изучено не достаточно. Данная работа посвящена исследованию первых 6-ти видов герпесвирусов человека.

Социально-экономический ущерб, наносимый -герпесвирусами, трудно переоценить. Среди заболеваний, вызванных инфекцией вирусом простого герпеса, наибольшее значение имеет генитальный герпес, заболеваемость которым в разных странах достигает 80 – 200 случаев на 100 тыс. населения, и этот показатель продолжает расти. По данным официальной статистики, в России показатель заболеваемости генитальным герпесом составляет 8-9 случаев на 100 тыс.





населения, что, очевидно, не соответствует истинному положению и, прежде всего, связано с недостаточным клинико-диагностическим обследованием больных. В США, по данным CDC, 45 миллионов людей старше 12 лет, или 1 из 5 подростков и взрослых заражаются ВПГ-2. Начиная с конца 1970-х годов, количество людей с генитальным герпесом в этой стране увеличилось на 30%. Вероятно, при соответствующем уровне диагностики и статистических оценок, сходные показатели могут быть зарегистрированы в России. Не менее значительный ущерб здоровью наносит и окулярный герпес. Около половины случаев поражения роговицы и слепоты, вызванной инфекционными болезнями, связывают с герпетической инфекцией. Тяжелейшей герпесвирусной инфекцией является энцефалит, требующий экспресс-диагностики и неотложной помощи, частота которого увеличилась вдвое в последние 5-10 лет.

В настоящее время практически во всех развитых странах Запада существует вакцинопрофилактика детей против ветряной оспы. До введения VARIVAX вакцины в Соединенных Штатах Америки регистрировалось около 4 млн. случаев ветряной оспы в год (количество, эквивалентное числу новорожденных), что ежегодно приводило к 8 000случаям госпитализации и, по крайней мере, к 100 смертельным случаям. В России вакцинация против ВВО отсутствует.

Возрастающая угроза биотерроризма требует разработки дифференциальной экспресс-диагностики -герпесвирусов, которая позволит дифференцировать натуральную и ветряную оспу на ранних этапах клинических проявлений.

Сероэпидемиологические исследования -герпесвирусных инфекций показывают, что цитомегаловирусная инфекция широко распространена в человеческой популяции от развитых, промышленных сообществ до различных групп аборигенов. Инфекция ЦМВ превалирует среди детей и подростков развивающихся стран, и в нижних социальноэкономических слоях экономически-развитых стран. Социально-экономическое значение этой инфекции прежде всего связывают с поражением герминативного эпителия у мужчин и женщин. У мужчин такие поражения приводят к полиплоидии сперматозоидов и к бесплодию. Оценка распространенности инфекции ЦМВ среди здоровых семейных пар в Юго-Западной Азии, обращающихся за медицинской помощью по поводу бесплодия колеблется от 25,3% до 92%. Чрезвычайно актуально выявление острой инфекции у беременных женщин, т.к. почти все случаи мертворождения инфекционной природы связывают с этой инфекцией. Не менее важно выявление инфекции ЦМВ во время беременности в связи с угрозой тератогенного эффекта. Широкое распространение ЦМВ среди людей, опубликованные данные о его связи с атеросклерозом и другими болезнями, диктуют необходимость разработки более совершенных видов диагностики и детального изучения его роли в патогенезе этих заболеваний.

Вирус герпеса человека 6 типа исследуется сравнительно недавно, и эпидемиология этой инфекции изучена недостаточно. Значительное количество работ посвящено роли ВГЧ-6 в патогенезе рассеянного склероза и других заболеваниях нервной системы.

Опубликован ряд работ, показывающих вовлечение этой вирусной инфекции в формирование синдрома хронической усталости. Инфекция герпесвирусом 6 типа проявляется в младенчестве в виде внезапной экзантемы, это - наиболее изученное проявление болезни. Разработка высокоспецифичной диагностики -герпесвирусных инфекций чрезвычайно актуальна ввиду их широкой распространенности и слабой изученности.

Инфекция вирусом Эпштейна-Барр (подсемейство – герпесвирусов) прежде всего ассоциируется с инфекционным мононуклеозом, лимфомой Биркита, носоглоточной (назофарингеальной) карциномой и лимфопролиферативными болезнями иммуносупрессивных лиц. В большинстве случаев инфекция ВЭБ протекает без видимых проявлений болезни. Среди взрослого населения планеты у 80-90% здоровых лиц регистрируется серологическое подтверждение инфекции вирусом ВЭБ в прошлом. Для вируса ЭпштейнаБарр, как и для других герпесвирусов человека, характерна скрытая (латентная) форма инфекции. В настоящее время значительно возросло количество онкозаболеваний, этиологическим агентом которых определен вирус Эпштейна-Барр. Все эти обстоятельства делают разработку диагностики – герпесвирусных инфекций важной и актуальной.

В России для выявления антител к герпесвирусам в крови пациентов до наших исследований использовался твердофазный иммуноферментный анализ (ИФА) на основе нативных антигенов. Анализ состояния разработок диагностических тестов для выявления антител к герпесвирусам в сыворотках больных показал, что принципиально важным в этой области является поиск и выбор высоко специфичных антигенов, прежде всего, полученных методами генной инженерии.

Цель и задачи исследования Целью настоящего исследования было конструирование видоспецифичных рекомбинантных антигенов и выявление генетических маркеров герпесвирусов 1-6 типов для диагностики соответствующих герпесвирусных инфекций человека.

Для достижения поставленной цели необходимо было решить следующие задачи:

1. На основе анализа литературных данных выбрать иммунодоминантные белки герпесвирусов 1-6 типов человека для конструирования на их основе видоспецифичных рекомбинантных антигенов.

2. С помощью компьютерного анализа аминокислотных последовательностей выбранных белков-антигенов герпесвирусов определить в их структуре потенциальные антигенные детерминанты и кодирующие их участки соответствующих генов, а также подобрать олигонуклеотиды-праймеры и оптимальные условия ПЦР для амплификации выбранных районов генов исследуемых герпесвирусов.

3. Амплифицировать и клонировать выбранные районы геномов референсных штаммов герпесвирусов 1-6 типов человека в клетках E.coli в составе плазмидных экспрессирующих векторов. Наработать, очистить и оценить пригодность для диагностики полученных рекомбинантных антигенов:

• разработать вариант экспрессирующего плазмидного вектора, кодирующего шестигистидиновый тракт (6His), формирующий на С-конце целевого рекомбинантного белка аффинную мишень для очистки белка на металлохелатных сорбентах,

• клонировать выбранные фрагменты геномных ДНК исследуемых герпесвирусов в клетках E.coli в составе экспрессирующего вектора и получить штаммыпродуценты соответствующих видоспецифичных рекомбинантных антигенов,

• подобрать оптимальные условия очистки рекомбинантных белков-антигенов и наработать их в препаративных количествах,

• используя стандартные панели сывороток и сыворотки от больных герпесвирусными инфекциями, оценить возможность использования полученных рекомбинантных антигенов для выявления в сыворотках больных иммуноглобулинов, специфичных к соответствующим типам герпесвирусов,

• разработать панель сывороток человека для выявления иммуноглобулинов, специфичных к цитомегаловирусу,

• получить флуоресцентные антисыворотки к рекомбинантным антигенам цитомегаловируса.

4. Провести сравнительный анализ нуклеотидных последовательностей геномов герпесвирусов 1-6 типов человека, депонированных в международных электронных базах данных, с целью выявления специфичных для них генетических маркёров:

• выявить районы геномов, перспективные для использования в качестве генетических маркеров соответствующих типов герпесвирусов,

• с учетом вариабельности выбранных генетических районов герпесвирусов разработать олигонуклеотиды-праймеры, условия и кинетику амплификации методом ПЦР выбранных генетических маркеров,

• создать лабораторные варианты и апробировать разработанные способы обнаружения геномных ДНК герпесвирусов 1-6 типов методом ПЦР на коллекции референсштаммов герпесвирусов человека, а также на клиническом материале от больных.

Научная новизна В ходе работы впервые проведена комплексная оценка иммунодоминантных районов вирионных белков герпесвирусов человека 1-6 типов. Выявлены потенциальные антигенные детерминанты в иммунодоминантных районах белков шести типов герпесвирусов человека. Сконструирован плазмидный вектор, обеспечивающий экспрессию клонированных в его составе чужеродных генов с образованием белков, содержащих дополнительную шестигистидиновую последовательность в С-концевой области цепи, позволяющую осуществлять аффинную очистку белка на металлохелатных сорбентах. Необходимость создания такого вектора была обусловлена отсутствием в то время конструкций, формирующих на С-конце 6His мишень для очистки полноразмерной копии белка. Существовали только конструкции, обеспечивающие экспрессию генов с образованием белков, имеющих аффинную мишень на N-конце.

На основе обнаруженных уникальных аминокислотных последовательностей в вирионных белках герпесвирусов (ВПГ-1, ВПГ-2, ВВО, ЦМВ, ВГЧ-6 и ВЭБ) разработаны рекомбинантные антигены, специфичные для соответствующих типов герпесвирусов человека:

• вирусов простого герпеса 1 и 2 типов: рек-gD-1 (ВПГ-1) и рек-gG-2 (ВПГ-2).

• вируса ветряной оспы и опоясывающего лишая: рек-gE (ВВО).

• цитомегаловируса человека (ЦМВ): рек-рр150, рек-IE2, рек-р52 и рек-рр65.

• вируса герпеса человека 6-го типа (ВГЧ-6): рек-р100 и рек-р41.

• вируса Эпштейна-Барр (ВЭБ): рек-р18 и рек-р54.

Продемонстрирована перспективность использования полученных в данной работе рекомбинантных белков в качестве специфичных антигенов для выявления антител к соответствующим типам герпесвирусов.

Выявлены новые генетические маркеры герпесвирусов человека 1-6 типов.

Практическая ценность работы Практическая значимость данного исследования состоит в разработке рекомбинантных антигенов, специфичных для герпесвирусов 1-6 типов и перспективных для создания на их основе отечественных высокочувствительных диагностических систем удовлетворяющих требованиям клинической практики.

С помощью разработанных в рамках данного исследования рекомбинантных антигенов рек-рр150, рек-р52 и рек-рр65 в ЗАО «Медико-биологический союз» (г. Новосибирск) создана и утверждена в ГИСК им. Л. А. Тарасевича стандартная панель сывороток человека для контроля иммуноферментных диагностических тест-систем, выявляющих IgG к цитомегаловирусу человека. Стандартная панель внесена в Реестр национальных стандартных образцов РФ под номером: ОСО 42-28-360-01.

На основе сконструированных в настоящей работе антигенов ЗАО «Медикобиологический союз» (Новосибирск) разработана иммуноферментная тест-система для определения антител в сыворотке крови к цитомегаловирусу человека. Разработанные рекомбинантные антигены герпесвирусов в настоящее время используются для создания иммуноферментных тест-систем такими отечественными производителями, как: ЗАО «Вектор-Бест» (Новосибирск), ЗАО «Медико-биологический союз» (Новосибирск) и ЗАО «ИмДи» (Новосибирск).

Получены меченые моноспецифические кроличьи антисыворотки к рекомбинантным антигенам рек-IE2 и рек-рр65 цитомегаловируса, позволяющие выявлять этот вирус в клинических образцах с помощью иммунофлуоресцентного анализа in situ.

Созданы лабораторные варианты тестов для обнаружения герпесвирусов человека, основанные на амплификации методом ПЦР выявленных в настоящей работе генетических маркёров соответствующих типов герпесвирусов. Показана перспективность создания на их основе коммерческих тест-систем. В настоящее время часть их из них используется в ЗАО «Вектор-Бест» (Новосибирск) для создания диагностических тест-систем.

Значительная часть разработанных в работе генетических конструкций, олигонуклеотидов защищена патентами Российской Федерации.

Разработанные способы диагностики инфекций, вызываемых герпесвирусами 1-6 типов, могут быть использованы в клинической диагностической практике, для скрининга донорской крови, которая пока в России не тестируется на присутствие вирусов данной группы, в трансплантологии и для проведения мониторинга различных групп населения во время эпидемиологических обследований.

Положения, выносимые на защиту

1. Сконструированные экспрессирующие плазмидные конструкции, включающие фрагменты генов герпесвирусов человека, обеспечивают биосинтез в клетках E. coli рекомбинантных белков, содержащих иммунодоминантные области антигенов герпесвирусов 1-6 типов.

2. Использование рекомбинантных антигенов герпесвирусов 1-6 типов в ИФА позволяет выявлять антитела в сыворотке крови человека, специфичные для соответствующих герпесвирусов.

3. Сконструирован бактериальный (E. coli) экспрессирующий вектор на основе плазмидной ДНК pUR290-6*his. Отличительными особенностями этой конструкции является кодирование шестигистидинового тракта (6His), который формирует на С-конце целевого рекомбинантного белка аффинную мишень для очистки полноразмерной копии белка на металлохелатных сорбентах, и биосинтез -галактозидазы, которая в конечной конструкции укорачивается до небольшого размера и обеспечивает высокий уровень сорбции белка на полистирольных планшетах.

4. Флуоресцентные антисыворотки к рекомбинантным белкам рек-рр150, рек-IE2 и рек-рр65 цитомегаловируса позволяют выявлять этот вирус в клинических образцах с помощью иммунофлуоресцентного анализа in situ.

5. Стандартная панель сывороток, содержащих и не содержащих антитела класса G к цитомегаловирусу человека (ОСО 42-28-360-01) позволяет контролировать качество иммуноферментных тест-систем, выявляющих специфические IgG к ЦМВ.

6. Олигонуклеотидные праймеры к генам US-6 (ВПГ-1) и UL44 (ВПГ-2), UL36 (ВВО), UL55 (ЦМВ), BKRF1 (ВЭБ) и U11 (ВГЧ-6), используемые в ПЦР, позволяют обнаруживать геномные ДНК различных штаммов и клинических изолятов соответствующих типов герпесвирусов.

Конкретное участие автора в получении результатов Участие автора при проведении всех исследований по диссертации заключается в личном проведении и участии практически во всех экспериментальных и теоретических работ. А также в научном руководстве и соруководстве исследований по герпесвирусам, выполняемых в лабораториях ФГУН ГНЦ ВБ "Вектор", совместно с сотрудниками других институтов и производственных фирм.

Апробация работы

Представленные в диссертации результаты были доложены на различных конференциях и симпозиумах: Международной конференции " A multidisciplinary approach towards controlling cytomegalovirus disease" (Sweden, Stockholm, 1995), Международной конференции “The 22nd International Herpesvirus Workshop”(La Jolla, California,1997), Юбилейная конференция, посвященная 30-летию журнала "Молекулярная биология" (Москва,1997), Международной конференции “CMV 7th International Workhop” (Brighton, UK, 1999), Международной конференции «Assessment of Sponsored Biological Research in Russia for the New Millennium» (Russia, 1999), Российской научно-практической конференции «Генодиагностика инфекционных болезней» (Россия, 2005).

Публикации По материалам исследований опубликовано 15 статей в реферируемых научных журналах и получено 10 патентов Российской Федерации.

Структура работы Диссертация состоит из введения, литературного обзора, главы материалы и методы и главы из 5 разделов, отражающих результаты собственных исследований и их обсуждения, выводов и приложений. Работа изложена на 416 с, включая 62 таблицы и 127 рисунков. Список литературы из 657 наименований включает 35 отечественных работ.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

Теоретический анализ иммунодоминантных белков герпесвирусов человека 1-6 типов В настоящее время в ИФА используют денатурированные формы белков, которые обеспечивают высокую однородность сорбции на планшете и стабильность величины оцениваемой оптической плотности. Поэтому этот раздел нашей работы был посвящен выявлению только непрерывных или линейных антигенных детерминант.

Анализ нуклеотидных и аминокислотных последовательностей осуществляли с помощью компьютерной программы Alignment Service (v. 4.1.). Для поиска гомологов белков использовали компьютерную систему создания банка образов белковых семейств PROF_PAT 1.0. Теоретический анализ структуры белка осуществляли с использованием программы PC/GENE и разработанных в ГНЦ ВБ «Вектор» программ SALIX и Alignment Service. Нуклеотидные последовательности геномных ДНК и аминокислотные последовательности белков герпесвирусов человека 1-6 типов, были получены из банка данных GeneBank и анализировались с помощью компьютерной программы ClustalX.

-Герпесвирусы Вирусы простого герпеса 1 и 2 типа По данным литературы, при инфекции максимальное количество иммуноглобулинов крови вырабатывается на структурные белки вируса, и среди этих белков наиболее сильные антигены - гликопротеины gD, gB, gC и gG, кодируемые генами US6, UL27, UL44 и US4, соответственно. Гликопротеины gD-1 и gD-2 достаточно гомологичны между собой, но C-концы этих белков имеют низкую степень гомологии. Показано, что специфические антитела к ВПГ-1 вырабатываются иммунной системой инфицированного человека именно к C-концевой линейной части белка. Гликопротеин, gD, играет основную роль в В-клеточном иммунном ответе к ВПГ. Были идентифицированы четыре области gD (I-IV), важные для вирусного морфогенеза. Показано, что мутации в этих областях gD препятствуют появлению полноценного инфекционного вируса. Кроме того, они затрагивают иммунодоминантные районы и препятствуют формированию антигенных эпитопов (рис. 1).

Рис. 1. Схематическое изображение полноразмерной последовательности gD ВПГ. Полноразмерная последовательность в вирионах ВПГ. Размер gD-1 - 393 а.о. Размер gD-2 - 392 а.о.

Каждый из них имеет сигнальную последовательность для секреции, имеет три N-сцепленных углевода (круги), три дисульфидных связи (С-С) - штриховая линия. Мутации, ассоциированные с функцией, накапливаются в четырех областях (I - IV). Прямоугольниками черного цвета обозначены гипотетические антигенные детерминанты 1-7, по данным литературного анализа.

Учитывая данные литературного анализа, этот гликопротеин мы выбрали в качестве кандидата на создание рекомбинантного антигена ВПГ-1.

–  –  –

Компьютерный анализ аминокислотной последовательности белка gD-1 (ВПГ-1) с помощью программы PC/GENE выявил основные гипотетические линейные антигенные детерминанты (рис. 2). Поэтому для амплификации гена белка gD-1 выбрали только область, кодирующую C-концевую гидрофильную часть этого белка, с 269 по 392 а.о. (размер ДНК-фрагмента, включая праймеры, 395 п.н.) и содержащую все 3 антигенных эпитопа, предсказанных компьютерным анализом.

Одним из основных антигенов вируса простого герпеса 2 типа является гликопротеин G (gG). Он кодируется геном US4 и представляет собой гликозилированный белок с молекулярной массой 100 кДа и является одним из белков, составляющих оболочку вируса. Как показано в значительном количестве работ, в отличие от других вирусных гликопротеинов этот гликопротеин является высоко специфичным антигеном ВПГ-2. Этот вирусный белок не имеет серологического сродства с белками других герпесвирусов человека и содержит от 3-х и более антигенных эпитопов (по данным разных авторов), сосредоточенных в С-конце молекулы и обладающих высокой специфичностью по отношению к антителам, специфичным к ВПГ-2.

Для поиска гомологов белка gG-2 ВПГ-2 среди всех известных белков была построена база данных образов белков, гомологичных gG-2. Поиск гомологов gG-2 ВПГ-2 в системе PROF_PAT 1.0 выявил 19 аминокислотных последовательностей из банка SwissProt: 12 - штаммов ВПГ-2, 7 - штаммов ВПГ-1. При этом последовательности генов, кодирующих gG-1 и gG-2, показывают значительные различия. При степени гомологии не более 40% в банке образов остаются только гомологи gG ВПГ-1,2. Гликопротеины gG-1 и

gG-2 содержат 238 и 699 а.о., соответственно. Компьютерный анализ аминокислотной последовательности белка gG-2 с помощью программы PC/GENE выявил основные гипотетические линейные антигенные детерминанты (рис.3):

–  –  –

Уровень гомологии между эпитопами гликопротеинов G у вирусов ВПГ-2 и ВПГчрезвычайно низок. Это дает нам основание считать, что использование рекомбинантного аналога С-концевой части белка gG-2 в качестве антигена не вызовет перекрестных серологических реакций с антителами к ВПГ-1. Поэтому для амплификации гена и последующего клонирования, с целью получения рекомбинантного антигена мы выбрали район с 438 по 695 а.о. gG2 (US4) ВПГ-2.

Вирус ветряной оспы и опоясывающего лишая Гликопротеин gpI или gE (ORF68) обильно продуцируется в инфицированных ВВО клетках. Показано, что gpI самый иммуногенный среди гликопротеинов ВВО, стимулирующий гуморальный и клеточный иммунитет. Использование этого нативного гликопротеина в качестве антигена показывает его высокую специфичность и очень слабую перекрестную реактивность.

Сравнение аминокислотных последовательностей данного белка разных штаммов, полученных из базы данных SWISSPROT Protein Sequence Database Release, показало полную штаммовую гомологию этих последовательностей и очень низкую гомологию с аналогами этого белка среди других герпесвирусов (менее 50%). Сравнение аминокислотных последовательностей белка gE пяти штаммов и изолятов ВВО говорит о полной гомологии и очень высокой консервативности этого белка. Это практически уникальный случай среди герпесвирусных гликопротеинов. Анализ вторичной структуры белка позволил выявить наиболее вероятные области формирования ядер антигенных эпитопов.

–  –  –

С помощью компьютерного анализа в аминокислотной последовательности белка gE нами было выявлено наличие 3-х антигенных эпитопов с линейными детерминантами (рис.4). Поэтому для клонирования и получения рекомбинантного белка на основе gE был выбран фрагмент гена, кодирующий все три эпитопа с 25 по 344 а.о.

-Герпесвирусы Цитомегаловирус человека Анализ данных литературы по антигенному спектру белков цитомегаловируса человека показал, что среди его антигенов белки pp150, IE2, p52 и pp65 являются наиболее перспективными кандидатами для создания на их основе рекомбинантных антигенов. Поэтому наше внимание было сосредоточено на получении рекомбинантных антигенов на основе этих белков.

Представляемая работа начиналась в начале 90-х годов и первым, созданным рекомбинантным антигеном, был антиген рек-IE2 ЦМВ. К сожалению, в то время в нашей стране отсутствовали возможности компьютерного анализа. Поэтому выбор антигена, иммунодоминантной части и кодирующей его нуклеотидной последовательности был полностью основан на зарубежных литературных данных. В начале 90-х годов значительная часть исследователей с получением рекомбинантного IE2 связывала возможность создания на его основе высокоспецифичной ранней ИФА-диагностики. Логика таких, в том числе и нашей, работ основывалась на том, что это предранний белок, экспонируемый на мембране зараженной клетки. Предполагалось, что на него в первую очередь будут нарабатываться антитела, как на одного из первых белков, презентуемых иммунной системе в ходе развития инфекции ЦМВ. Однако уже после первых работ по получению рекомбинантных форм белка IE2 интерес исследователей, стремящихся создать достоверную ИФА-диагностику, практически полностью пропал к этому антигену. В ходе ЦМВ инфекции к этому белку, конечно, нарабатываются антитела, но в большинстве случаев их уровень и время появления недостаточно достоверно связано с фазами инфекции. Мы выбрали для клонирования всю последовательность гена IE2 (984 п.о.).

Не смотря на слабую серологическую реактивность, свойство IE2, экспонироваться на мембранах зараженных клеток в ранней фазе инфекции, в настоящее время эффективно используется в клинической диагностике острой инфекции ЦМВ. Меченые моноклональные антитела и моноспецифические антисыворотки к нему позволяют с помощью микроскопии выявлять продуктивную инфекцию в той или иной ткани.

Главный матричный фосфопротеин рр150. Компьютерный анализ первичной структуры белка позволил определить локализацию иммунодоминантных областей, специфичных для ЦМВ и перспективных для создания на их основе рекомбинантного аналога антигена рр150. Нами было обнаружено три гипотетических антигенных детерминанты, которые отмечены на рис. 5. Сравнение аминокислотных последовательностей белка pp150 ЦМВ с аналогичным белком р100 ВГЧ-6 показало, что эти эпитопы расположены в негомологичных районах белка. С целью получения рекомбинантного белка рек-pp150 для клонирования была выбрана нуклеотидная последовательность гена UL32, кодирующая гидрофильную область белка 369-760 а.о. (размер ДНК-фрагмента 1176 н.о.) белка.

–  –  –

ДНК-связывающий белок p52 (ген UL44). Локализацию линейных антигенных детерминант осуществляли в аминокислотной последовательности, полученной из базы данных SWISSPROT (Protein Sequence Database Release 42.0). Анализ вторичной структуры белка позволил определить три наиболее вероятные области формирования ядер антигенных эпитопов.

–  –  –

Рис. 7. Гипотетическая структура конформации белка р52 на ядерной мембране. Ag1, Ag2 и Ag3 – гипотетические антигенные эпитопы. NGS – сайт гликозилирования, RGD – сайт адгезии.

Спиралевидной линией обозначен трансмембранный участок. G1–G5 – гидрофобные участки белка состоящие из глициновых повторов.

В результате были выявлены гипотетические антигенные детерминанты, ядра эпитопов, трансмембранный домен, сайты адгезии, участок связывания ДНК и построена модель конформации белка р52, локализованного на ядерной мембране (рис. 7). Таким образом, выяснилось, что лишь два из трех гипотетических эпитопов способны с наибольшей вероятностью быть антигенными детерминантами, т.к. один эпитоп расположен в зоне трансмембранного и ДНК-связывающего домена. При конструировании рекомбинантного антигена рек-p52 было решено клонировать область гена, кодирующую гидрофильную часть белка с 200 по 341 а.о. (размер ДНК-фрагмента 731 п.о.) и содержащую два антигенных эпитопа в своем составе. Выбранная область не содержит гомологий с аналогами ДНК-связывающего белка других типов герпесвирусов.

Матричный белок тегумента рр65. Белок pp65 (белок тегумента вириона, ген UL83) был выбран как следующий кандидат для создания рекомбинантного антигена.

Этот белок считают «маркером патогенности» и он индуцирует синтез специфических антител на ранних стадиях продуктивной инфекции.

Компьютерный анализ аминокислотной последовательности белка рр65 ЦМВ выявил наиболее гидрофильные области, и с учетом особенностей вторичной структуры, распределения зарядов и гидрофобности были предсказаны три потенциальные антигенные детерминанты (рис. 8).

Исходя из полученных данных, область гена белка pp65, кодирующая гидрофильную часть этого белка с 231 по 551 а.о. и содержащая все антигенные эпитопы, предсказанные компьютерным анализом, была выбрана нами для амплификации методом ПЦР и последующего клонирования составе экспрессирующих векторов в клетках E. coli.

–  –  –

Вирус герпеса человека 6 типа Структурный белок p100, или белок тегумента (ген U11) вируса герпеса человека 6 типа является фосфопротеином (обозначается как рр100), активно реагирующим с сыворотками крови человека при иммунологическом анализе.

–  –  –

В ходе компьютерного анализа был идентифицирован ген U11, кодирующий данный белок, и определена его нуклеотидная последовательность для А- и В-типов ВГЧАнализ также позволил нам предположить, что в аминокислотной последовательности белка p100 имеется 3-х антигенных эпитопа с уникальными линейными детерминантами (рис.9). Для амплификации гена белка p100 выбрали область, кодирующую район белка p100 с 494 по 842 а.о. и содержащую 3 гипотетических антигенных эпитопа.

Белок p41 ВГЧ-6, кодируемый геном U27 (старое название EPLF1), является гомологом белка ICP36, относящегося к семейству фосфорилированных и гликозилированных белков, которые кодируются геном UL 44 ЦМВ человека. Иммунохимические исследования с сыворотками пациентов с инфекцией герпесвируса 6 типа, показали, что белок p41 активно взаимодействует с вирусспецифическими IgM- и IgG-антителами к ВГЧ-6. В настоящее время он используется в качестве антигена при проведении ИФА. Компьютерный анализ аминокислотной последовательности белка p41 с помощью программы PC/GENE выявил основные линейные антигенные детерминанты (рис. 10).

Практически ничего неизвестно в литературе об антигенном спектре этого белка.

Поэтому в качестве района для последующего клонирования кодирующей последовательности и создания рекомбинантного антигена рек-р41 ВГЧ-6 мы выбрали всю последовательность белка (с 1 по 363 а.о.).

–  –  –

-Герпесвирусы Вирус Эпштейна-Барр Известно, что на острых стадиях развития инфекции ВЭБ в сыворотках крови больных обнаруживают IgM-антитела к вирусному капсидному антигену VCA, а также IgG к раннему антигену EA. В большинстве случаев при этом антитела связываются с р18 (VCA) и р54 (EA-D). Именно эти белки были выбраны для получение рекомбинантных антигенов, содержащих иммунодоминантные фрагменты белков р18 и р54.

Методами компьютерного анализа были выявлены гипотетические антигенные детерминанты на аминокислотных последовательностях белков р18 (VCA) и р54 (EA-D) вируса Эпштейна-Барр (ВЭБ) (см. рис. 11 и 12, соответственно).

–  –  –

А Б 66-72 : Gly-Val-Pro-Arg-Arg-Gln-Arg 75-81 : Asp-Lys-Arg-Gln-Arg-Ala-Ser Рис. 11. Профиль гидрофильности белка р18 при выборке из 7 – (А) и 5 – (Б) аминокислотных остатков в эпитопе (координаты: ось абсцисс – длина белка в а.о., ось ординат – индекс гидрофильности). На графике А прямоугольниками выделены области гипотетических антигенных эпитопов (последовательности гипотетических детерминант указаны в сносках).

–  –  –

Рис. 12. Профиль гидрофобности белка р54 при выборке из 7 – (А) и 5 – (Б) аминокислотных остатков в эпитопе (координаты: ось абсцисс – длина белка в а.о., ось ординат – индекс гидрофильности). На графике А прямоугольниками выделены области гипотетических антигенных эпитопов (последовательности гипотетических детерминант указаны в сносках).

На рис.11А показаны три основные гипотетические детерминанты белка р18 при выборке 7 а.о. При выборке 5 а.о. в этом белке выявлялись и другие гипотетические детерминанты, равномерно представленные в N-концевой части белка (см. рис. 11Б). Поэтому для клонирования иммунодоминантного района была выбрана полная нуклеотидная последовательность гена BFRF3 белка р18. Аналогичным образом были выявлены 4 основные гипотетические детерминанты при выборке 7 а.о. (см. рис.12А) белка р54. Следует заметить, что в районе 78 – 391 а.о. были выявлены и другие гипотетические детерминанты при выборке 5 а.о. (рис.12Б). Фрагмент гена BMRF1, кодирующий этот иммунодоминантный район, был выбран для клонирования. В обоих белках были выявлены области гидрофобности. Однако уровень гидрофильности этих участков не превышал 0.42-0.68 и поэтому рассматривать их как трансмембранные домены представляется маловероятным.

Сравнение аминокислотных последовательностей со всеми белками других герпесвирусов человека показало отсутствие гомологии выявленных иммунодоминантных районов р18(VCA) и р54(EA) с белками других герпесвирусов. Это позволило нам надеяться, что выбранные районы окажутся уникальными, а рекомбинантные белки будут взаимодействовать только со специфическими к ВЭБ антителами.

Клонирование и экспрессия выбранных генов Получение и очистка рекомбинантных белков Иммуноферментный анализ Для получения высокоочищенных рекомбинантных антигенов в нашей лаборатории, лаборатории герпесвирусов ГНЦ ВБ «Вектор», была сконструирована плазмида для интеграции чужеродных генов, в которой за клонированной последовательностью в рамке считывания следовала последовательность, кодирующая полигистидиновый тракт. Наличие на С-конце рекомбинантного белка мишени из 6 остатков His позволяет использовать её для выделения с помощью аффинной хроматографии металлохелатные смолы (например, Ni-NTA resin) и получать уровень очистки 90-95%. Наличие в нашей конструкции на С-конце рекомбинантного белка аффинной мишени, в отличие от существовавших в то время коммерческих конструкций, в которых полигистидиновый тракт чаще расположен на N- конце, при выделении на металлохелатной смоле однозначно подтверждало экспрессию гена и биосинтез полноразмерного кодируемого им рекомбинантного белка.

Наша экспрессирующая плазмидная конструкция была сделана на основе плазмиды pUR290. Отличительными особенностями этой конструкции является биосинтез полноразмерной -галактозидазы (которая в конечной конструкции укорачивалась до небольшого размера), генетический маркер - ген -лактамазы (bla), определяющий устойчивость трансформированных плазмидой клеток E. coli к ампициллину, и высокая устойчивость к рекомбинации при пассировании. Использование этой конструкции приводит к накоплению продукта в нерастворимой форме в виде телец включения (inclusion body) в клетках E.coli. Это существенно повышает выход синтезируемого белка в сравнении с растворимыми формами. В производстве ИФА-тест-систем обычно используют денатурированные формы белков антигенов. Это позволяет улучшить однородность сорбции белка на планшетах, что приводит к повышению стабильности, важной характеристике для воспроизведения результатов, особенно при стандартизации тест-системы в целом. При этом максимальную однородность сорбции показывают гидрофобные белки, полученные в денатурирующих условиях. Во всех наших случаях были получены в составе клеточных включений гидрофобные химерные белки, состоящие из фрагмента -галактозидазы и антигена, заканчивающегося 6His-аффинной мишенью. Эти рекомбинантные белки эффективно сорбировались на полистирольных планшетах с помощью гидрофобного якоря, представленного коротким фрагментом -галактозидазы, и экспонировали в реакционное пространство гидрофильную часть, т.е. антиген.

Промежуточную плазмидную ДНК pUR290-6*his, кодирующую последовательность из 6 His, конструировали так, что она располагалась после сайта узнавания эндонуклеазой рестрикции SalI. Для этого ДНК pUR290 обрабатывали последовательно эндонуклеазой рестрикции HindIII, фрагментом Кленова (достройка до тупоконечного фрагмента) и эндонуклеазой рестрикции SalI, и лигировали с синтетическим адаптером длиной 50 п.

н., обработанным предварительно в следующем порядке: эндонуклеаза рестрикции KpnI, фрагмент Кленова (достройка до тупоконечного фрагмента) и эндонуклеаза рестрикции

SalI:

KpnI SalI

5’-ATCAGGTACCTTAGTGATGGTGATGGTGATGGTCGACAGCATCATCTTCT-3’

TAGTCCATGGAATCACTACCACTACCACTACCAGCTGTCGTAGTAGAAGA

***HisHisHisHisHisHis Выросшие колонии клонов проверяли: на присутствие вставки гидролизом эндонуклеазой рестрикции EcoRI (116 п.н.) и отсутствие сайта эндонуклеазы рестрикции PstI.

Таким образом, был отобран клон, плазмидная ДНК (pUR290-6*his) которого содержала последовательность синтетического адаптера.

-Герпесвирусы Вирус простого герпеса 1 типа Амплифицированный ДНК-фрагмент (ампликон) гена US6 ВПГ-1, полученный с помощью ПЦР, компонентами которой были праймеры, в нуклеотидной последовательности которых присутствовали сайты эндонуклеаз рестрикции BamHI и SalI соответственно прямому и обратному праймерам, и ДНК pUR290-6*his обрабатывали последовательно эндонуклеазами рестрикции BamHI и SalI. Затем выделяли в 4% полиакриламидном геле фрагмент гена US6 длиной 372 п.о. и фрагмент вектора длиной 5370 п.о. Концы полученного фрагмента и вектора лигировали.

Рис. 13. Физическая карта рекомбинантной плазмиды pHSVD1.

Целевая плазмида pHSVD1 получается в результате обработки плазмидной ДНК pUR290-D1-6*his эндонуклеазами рестрикции BamHI, EcoRV, фрагментом Кленова с последующим лигированием (рис. 13).

После определения первичной структуры клонированного гена методом Максама-Гилберта полученные результаты сравнивали с известными литературными данными для различных штаммов ВПГ-1. Нуклеотидная последовательность клонированного гена US6 ВПГ-1 полностью совпадала с аналогичной для этого фрагмента штамма KOS ВПГ-1 (GeneBank Database, L09245).

На рис. 14 приведена картина электрофоретического разделения в SDS-ПААГ белков из клеточных лизатов различных клонов E. coli. На этом же рисунке представлен аффинно-очищенный химерный белок, синтезирующийся в клетках, несущих плазмиду pHSVD1. Электрофоретическая подвижность химерного белка соответствовала расчетной молекулярной массе 45 кДа.

–  –  –

.

Вирус простого герпеса 2 типа Получали рекомбинантную плазмидную ДНК, обеспечивающую экспрессию фрагмента гена US4 ВПГ-2, кодирующего иммунодоминантную часть gG2 с 438 по 695 а.о. в составе плазмидного вектора, кодирующего фрагмент -галактозидазы (441 а.о.) и 6*His-мишень для аффинной очистки белка. На рис. 15 показана физическая карта полученной рекомбинантной плазмиды pHSVG2, обеспечивающей биосинтез рекомбинантного антигена рек-gG2 ВПГ-2. В отличие от предыдущей конструкции (pHSVD1) в составе клонируемого фрагмента гена US4 оказался сайт EcoRV. В составе LacZ имеется 2 сайта рестриктазы HpaI. В данном случае вместо сайта EcoRV был использован сайт HpaI.

–  –  –

Секвенирование встроенного фрагмента US4, кодирующего иммунодоминантную часть гликопротеина gG2, показало полное соответствие нуклеотидной последовательности аналогичного района гена US4 штамма MS ВПГ-2.

К сожалению, в настоящее время в России и во многих странах отсутствует стандартные панели сывороток на ВПГ-1 и ВПГ-2. Кроме того, на доступном для нас рынке тест-систем отсутствуют наборы, позволяющие выявлять с помощью ИФА антитела к ВПГ-1 и ВПГ-2. Существуют только тест-системы, выявляющие антитела к вирусам простого герпеса, не разделяя их по типу.

В рамках проекта «Клинико-диагностические особенности течения генитальной герпетической инфекции в Новосибирске» (утвержден 19.03.2003 Этическим комитетом ГНЦ ВБ «Вектор», IRB00001360) нами было проведено ПЦР-обследование 238 человек.

Средний возраст больных составил 20–39 лет. Группа состояла из пациентов, обратившихся по поводу рецидивирующих высыпаний в аногенитальной области, проблем фертильности и вынашивания беременности. Среди этих пациентов было выбрано 16 человек, у которых в тех или иных клинических пробах (соскоб из цервикального канала, сперма и содержимое морфологических элементов высыпаний) была выявлена ДНК вирусов простого герпеса 1 и 2 типа (8 пациентов с ДНК ВПГ-1 и 8 пациентов с выявленной ДНК ВПГ-2).

–  –  –

специфичность (нативный антиген ВПГ-1) = 15/18*100%= 83%, специфичность (рекомбинантный антиген ВПГ-1) = 16/18*100%= 89%, специфичность (нативный антиген ВПГ-2) = 16/18*100%= 89%, специфичность (рекомбинантный антиген ВПГ-2) =17/18*100%=94%.

В этом исследовании нативные антигены были получены из вирусных референсштаммов ВПГ-1 и ВПГ-2 (коллекция АТСС, США). Анализ полученных данных с помощью ИФА показывал соответствие реагирования с одними и теми же сыворотками нативного и рекомбинантного антигенов ВПГ-1 с высокой степенью специфичности (83 и 89% соответственно). Аналогичные результаты получены и для нативного и рекомбинантного антигенов ВПГ-2 (89 и 94% соответственно). Таким образом, полученные результаты позволяют сделать вывод о перспективности использования в будущем разработанных рекомбинантных антигенов ВПГ-1 и ВПГ-2 в производстве ИФА-тест-систем для выявления специфических иммуноглобулинов.

Вирус ветряной оспы и опоясывающего лишая Выбранный участок гена gE был амплифицирован в ПЦР с матрицы, полученной при выделении суммарной ДНК из клеток Vero, инфицированных ВВО (изолят №4). Размер амплифицированного фрагмента составил 946 п.о., что полностью совпало с теоретически рассчитанной длиной фрагмента.

Нуклеотидная последовательность ампликона была определена методом Сенгера и показала полное соответствие участком гена ORF68 белка gE ВВО. Проведено клонирование амплифицированного фрагмента гена gE в составе плазмидного вектора в клетках E.coli (рис. 17), как описано ранее, т.е. сразу после амплификации в плазмидный вектор.

Была получена плазмидная конструкция pVZVgE-6his.

Искомые клоны отбирали по наличию биосинтеза рекомбинантного белка с теоретически рассчитанной электрофоретической подвижностью - 52 kDa (рис. 18, дорожка 2). Таким образом, были получены штаммы-продуценты E. coli рекомбинантного белка рек-gE. Уровень биосинтеза белка составил 80-90 мкг/мл. С использованием сорбента NiNTA-resin проведена аффинная очистка рекомбинантного белка рек-gE из клеточного лизата штамма-продуцента E. coli.

–  –  –

К сожалению, качество аффинного сорбента в значительной степени зависит от фирмы-производителя и это, прежде всего, приводит к присутствию разного количества клеточных белков в очищенном препарате. Поэтому 2-м этапом очистки была гельфильтрация на сефакриле S400 в денатурирующих условиях в присутствии 0,1% SDS. Таким образом, мы достигли уровня очистки более 95% (рис. 18, дорожка 3). В дальнейшем при очистке рекомбинантных антигенов, в том числе и описанных выше, мы всегда использовали двухступенчатый метод.

Для иммуноферментного анализа специфичных IgG к ВВО использовали белок после двух этапов очистки. ИФА проводили на сыворотках, выделенных от больных, инфицированных ВВО, с ярко выраженной клинической картиной кожных морфологических элементов, в содержимом которых с помощью ПЦР была выявлена ДНК ВВО. Использовалась и панель предприятия ЗАО «Вектор-Бест» (Новосибирск) положительных и отрицательных сывороток, собранных от больных с подтвержденным диагнозом и сывороток крови здоровых доноров.

–  –  –

До проведения этого исследования на доступном для нас рынке отсутствовали наборы, выявляющие антитела к ВВО. Всего нами было исследовано 72 сыворотки. В результате было показано, что полученный рекомбинантный белок рек-gE, реагирует с заведомо положительными сыворотками (от больных), а так же выявляет специфические антитела к ВВО на панели сывороток. Реакция протекает с различной чувствительностью и специфичностью по сравнению с нативным антигеном ВВО, традиционно используемым в такой диагностике. Из табл. 2 видно, что рекомбинантный белок обладает большей чувствительностью по сравнению с нативным антигеном. Также видно, что рекомбинантный белок увеличивает специфичность выявления положительных и отрицательных сывороток по сравнению с нативным антигеном. Так у положительных сывороток с №№ 5, 9, 10, 20 и 23 ОП в случае нативного антигена была близка к критичному значению и не могла считаться достоверно положительной. Использование рекомбинантного антигена помогло разрешить эти сыворотки как строго положительные, напротив отрицательные сыворотки с №№ 7 и 8, определенные вначале в присутствии нативного антигена как сомнительно

–  –  –

Рис. 19. Физические карты рекомбинантных плазмид pQE-UL32HCMV и pQEUL44HCMV, обеспечивающих биосинтез рекомбинантных антигенов рек-р52 и рек-рр150 ЦМВ в клетках E. сoli.

Для получения чистых форм рекомбинантных белков рек-р52 и рек-рр150 (без галактозидазы) фрагменты ДНК клонировали в клетках E.coli в составе плазмидных векторов серии pQE30 (Qiagen, Германия). Эти конструкции (pQE-UL44HCMV(рек-р52) и pQE-UL32HCMV(рек-рр150)) обеспечивали биосинтез чистых форм белков в E. сoli, т.е.

рекомбинантных полипептидов, содержащих иммунодоминантные области белков р52, рр150 ЦМВ и полигистидиновый тракт (6*His) на N-конце (рис. 19).

На рис. 20 приведена картина электрофоретического разделения в SDS-ПААГ аффинно-очищенных белков и клеточных лизатов клонов E. сoli, несущих плазмиды pQEUL44HCMV и pQE-UL32HCMV.

<

–  –  –

антигена как к IgG, так и к IgM ЦМВ. Так, из 48 ЦМВ-положительных сывороток реагировали со смесью рек-pp150-рек-p52 все 48, в отличие от 42 сывороток реагировавших только на рек-pp150, а из 38 ЦМВ-отрицательных сывороток не реагировали со смесью рекpp150-рек-p52 все 38, в отличие от 5 из них, реагировавших с рек-pp150. Отношение средних арифметических ОП (единицы оптической плотности в реакции ИФА) положительных и отрицательных сывороток позволяет оценить степень абсолютной чувствительности антигена. Чем выше это отношение, тем выше чувствительность. Абсолютная чувствительность IgG к ЦМВ и IgM к ЦМВ приведена в табл. 3. Из нее видно, что максимальной чувствительностью в ИФА обладает смесь белков рек-рр150 и рек-р52 в соотношении 5:1.

Уровень специфичности оценивался по достоверности различия выборок данных по ОП для положительных и отрицательных сывороток (табл. 4) с помощью статистического tкритерия (критерия Стьюдента). Расчеты показали, что самой высокой специфичностью при уровне достоверности 99% также обладает смесь белков рек-рр150:рек-р52 в том же соотношении – 5:1.

Таблица 4 Оценка степени варьирования выборок для положительных и отрицательных сывороток при достоверности 99%.

Для выборки положительных и отрицательных сывороток по IgG

Соотношение по белку антигенов рекАг-1-1:1 Аг-2-1:0 Аг-3-5:1 Аг-4-3:1 Аг-1-1:1

рр150 и рек-р52 Среднее арифметическое значение ОП отрицательных сывороток Доверительный интервал среднего ±167.73 ±145.04 ±69.12 ±135.29 ±118.46 арифметического значения ОП отрицательных сывороток Среднее арифметическое значение ОП положительных сывороток Доверительный интервал среднего ±874.87 ±569.18 ±630.74 ±919.81 ±499.37 арифметического значения ОП положительных сывороток Для выборки положительных и отрицательных сывороток по IgM

Соотношение по белку антигенов рекАг-1-1:1 Аг-2-1:0 Аг-3-5:1 Аг-4-3:1 Аг-1-1:1

рр150 и рек-р52 Среднее арифметическое значение ОП отрицательных сывороток Доверительный интервал среднего ±218.30 ±271.81 ±89.42 ±124.46 ±110.91 арифметического значения ОП отрицательных сывороток Среднее арифметическое значение ОП положительных сывороток Доверительный интервал среднего ±291.59 ±304.85 ±174.54 ±273.40 ±313.57 арифметического значения ОП положительных сывороток Таким образом, установлено, что наши рекомбинантные белки реагируют с поликлональными антителами класса G и M, присутствующими в сыворотках пациентов с заболеваниями, вызванными ЦМВ. На основании полученных данных можно сделать вывод о возможности использования смеси рекомбинантных белков рек-p52 и рек-pp150 для серодиагностики ЦМВ-специфичных IgM- и IgG-иммуноглобулинов. Однако следует отметить ряд выявленных недостатков: некоторую неоднородность результатов, связанную с особенностями сорбции чистых форм белков, а также сравнительно низкий выход рекомбинантных белков.

Использование сочетания рекомбинантных рек-р52 и рек-рр150 улучшило ситуацию с выявлением IgG и особенно IgM к ЦМВ, но всё же в некоторых случаях такая смесь оказалась малоэффективной. Поэтому наши дальнейшие усилия были направлены на получение рекомбинантного рек-рр65, который сегодня считают «маркером патогенности», и который индуцирует синтез специфических антител на ранних стадиях продуктивной инфекции.

Выбранный участок гена UL83, кодирующий гидрофильную часть этого белка с 231 по 551 а.о., клонировали в составе плазмидного вектора pUR290-6*his в клетках E.coli (рис. 21). На рис. 22 представлен очищенный аффинной хроматографией химерный белок, синтезирующийся в клетках, несущих плазмидой pUL83HCMV.

ORI P(LAC) Beta-gal fragment

–  –  –

Рис. 23. Физические карты плазмид pUL32HCMV и pUL44HCMV, обеспечивающих биосинтез рекомбинантных антигенов рек-р52 и рек-рр150 ЦМВ в клетках E. coli.

Чтобы окончательно убедиться в том, что варианты наших антигенов с фрагментом -галактозидазы (химерные) эффективнее в ИФА (за счет лучшей сорбции на полистироле) по сравнению с «чистыми» формами рекомбинантных белков, мы сравнивали эти две формы рекомбинантного рек-рр150, как наиболее реагирующего, на стандартной панели сывороток от пациентов с инфекцией ЦМВ. В табл. 5 приведены данные сравнения двух форм (химерной и «чистой») рек-рр150 на аттестованной панели.

Статистический анализ полученных данных показал:

С (для рек-рр150- химерный) = (15/16)*100% = 93,75%, С (для рек-рр150- «чистый») = (12/16)*100% = 75%.

Чувствительность по панели = (Р/20)*100%:

Ч (для рек-рр150- химерный) = (20/20)*100% = 100%, Ч (для рек-рр150- «чистый») = (19/20)*100% = 95%.

Из выше приведенных данных, очевидно, что чувствительность и специфичность «химерной» формы выше «чистой» формы антигена рек-рр150. Эти результаты убеждают в необходимости продолжения исследований по созданию и в дальнейшем рекомбинантных антигенов по разработанной нами стратегии.

В итоге были получены 3 штамма E. сoli, продуцирующие рекомбинантные антигены ЦМВ. На рис. 24 приведены результаты электрофоретического разделения в SDSПААГ аффинно-очищенных химерных белков рек-рр150, рек-р52 и рек-рр65, синтезирующихся в клетках, несущих плазмиды: pUL32HCMV, pUL44HCMV и pUL83HCMV.

–  –  –

Для оценки антигенных свойств полученных рекомбинантных белков рек-рр65 и рек-рр150 использовали разработанную с нашим участием и аттестованную ГИСК им.

Л.А. Тарасевича панель положительных и отрицательных сывороток к ЦМВ (табл. 6).

ИФА было показано, что сам по себе рекомбинантный рек-pp65 не мог являться достаточным критерием в качестве антигена для выявления антител, специфичных к ЦМВ, но в дополнении с рекомбинантным антигеном рек-pp150 значительно увеличивал чувствительность выявления таких сывороток. Как упоминалось выше, отношение средних арифметических ОП положительных и отрицательных сывороток позволяет оценить степень абсолютной чувствительности антигена. Чем выше это отношение, тем выше чувствительность. В табл. 6 мы видим, что смесь белков рек-рр150-рек-рр65 имеет более высокий показатель этого отношения, а значит и большую чувствительность. Уровень специфичности оценивали по количеству выявляемых сывороток в стандартной панели. Он показал такое же значение как для рек-рр150, так и смеси рек-рр150-рек-рр65, т.е. все отрицательные сыворотки остались отрицательными, а положительные - положительными.

Зная, что антитела к рр65 чаще всего появляются именно при острой фазе инфекции, мы провели сравнительный анализ (табл. 7) сывороток больных, перенесших трансплантацию почки, двумя методами – с помощью ИФА, в котором использовали антигены рек-pp150, рек-pp52 и рек-pp65 для обнаружения ЦМВ-специфичных IgM, и ПЦР.

–  –  –

При использовании в ИФА только рек-рр150 выявлены 5 положительных сывороток, однако в варианте с добавлением к первому рек-р52 и рек-рр65 количество таких сывороток увеличилось до 7. Таким образом, уже из этих результатов видно, что серодиагностика острой инфекции не может быть достоверно проведена с применением только одного антигена из ряда рек-рр150, рек-р52 и рек-рр65.

–  –  –

Результаты обследования пациентов, перенесших трансплантацию почки. Наличие вируса определяли методом ПЦР. Рек-pp150, рек-р52, рек-рр65 и рек-рр150/рек-рр65/рек-р52 – ИФА, где в качестве антигена использовали соответствующий рекомбинантный белок. Культ. АГ – ИФА, где антигеном служил нативный вирус ЦМВ (штамм AD-169).

–  –  –

Вирус герпеса человека 6 типа ПЦР-фрагмент ДНК, соответствующий размеру 1051 п.о. и кодирующий иммунодоминантную часть белка р100, был клонирован в клетках E.coli в плазмидном экспрессирующем векторе pU11HHV6 (рис.25).

На рис.26. приведена картина электрофоретического разделения белков в SDSПААГ из клеточных лизатов клонов E. coli. На этом же рисунке представлен аффинно очищенный химерный белок, синтезирующийся в клетках, несущих плазмиду pUHHV6.

Электрофоретическая подвижность химерного белка соответствует расчетной молекулярной массе 82,5 кДа.

–  –  –

Это связано с тем, что в литературе приводятся результаты обследований, которые широко различаются географией проживания обследуемого населения. Так, процент серопозитивных беременных в Марокко – 20%, в странах к югу от Сахары 50–90%, во Франции – 70%. Следует отметить, что высокую специфичность выявления IgG к ВГЧ-6 подтверждает хорошее совпадение результатов анализа IgG у матерей (рожениц) и их новорожденных детей – 98,7%: у новорожденных выявляются материнские антитела к ВГЧ-6. Несовпадения были зарегистрированы только в двух случаях, при этом матери были серопозитивными, тогда как у детей IgG-антитела не были выявлены.

Таким образом, в настоящей работе с использованием литературных данных и данных по теоретической структуре антигенных эпитопов белков p100 и р41 были выбраны последовательности ДНК генов U11 и U27, кодирующих иммунодоминантные части белков p100 и р41. Полученные в реакции амплификации фрагменты ДНК генов U11 и U27, кодирующие выбранные последовательности, клонировали в составе экспрессирующих векторов, которые обеспечили продукцию рекомбинантных белков рек-р100 и рекр41. Установлено также, что рекомбинантные антигены рек-р100 и рек-р41 реагируют с поликлональными антителами класса G, содержащимися в сыворотках инфицированных пациентов и здоровых доноров. На основании полученных данных можно сделать вывод о возможности использования полученных рекомбинантных белков в качестве антигенов при иммуноферментном анализе для выявления иммуноглобулинов класса G, специфичных к ВГЧ-6.

К сожалению, ситуация по серологическому мониторингу в отношении активности ВГЧ-6 в мире оставляет желать лучшего. Поэтому только в случае внезапной экзантемы детей в возрасте до 1 года можно получить однозначный серологический ответ. Все остальные варианты инфекции ВГЧ-6, например рассеянный склероз, синдром хронической усталости и т.п., до сих пор являются гипотетическими, и роль этого вируса в их патогенезе неоднозначна. Это создает значительные трудности в оценке диагностических возможностей и наших рекомбинантных антигенов рек-р100 и рек-р41, но никак не уменьшает ценность нашего исследования.

-Герпесвирусы Вирус Эпштейна-Барр Для клонирования фрагмента, кодирующего иммунодоминантный район белка р18, был выбран полноразмерный ген BFRF3. А для клонирования фрагмента гена BMRF1, кодирующего иммунодоминантный район белка р54, был выбран участок с 78 по 391 а.о.

–  –  –

Рис. 29. Физические карты плазмид HpUR-p18-6his и HpUR-p54-6his, экспрессирующие фрагменты ДНК, кодирующие выбранные районы белков р18 и р54 Были получены экспрессирующие плазмиды HpUR-p18-6his и HpUR-p54-6his (рис. 29). Отбор штаммов-продуцентов E.coli проводили по наличию синтезируемого белка. Электрофоретическая подвижность рекомбинантных белков совпала с рассчитанной теоретически. На рис. 30 показаны хроматографически очищенные рекомбинантные белки рек-р18 (VCA) и рек-р54 (EA).

–  –  –

Определение первичных структур ДНК клонированных генов показало, что первичные структуры, клонированных генов полностью совпали с аналогичными последовательностями, депонированными в мировых базах данных.

В рамках проекта «Разработка рекомбинантных антигенов и генетических маркеров для диагностики герпесвирусов» (утвержден 03.06.2003 Этическим комитетом ГНЦ ВБ «Вектор», IRB00001360) разработанные антигены использовали для ИФА сывороток из крови больных и здоровых людей. Было проведено исследование на выявление маркеров острой стадии ВЭБ-инфекции - IgG к ЕА ВЭБ (рек-р54) и IgM к VCA ВЭБ (рек-р18). В табл. 9 приведены данные обследования пациентов.

–  –  –

У больных с диагнозом инфекционный мононуклеоз (группа 4) IgG к EA были выявлены в 85% случаев, IgM к VCA – в 88% случаев. Количество пациентов, имеющих хотя бы один или два серологических маркера острой стадии ВЭБ-инфекции, составило 98%. Самое низкое количество сывороток, содержащих такие антитела (менее 2%) зафиксировано в группе 2. У 15% доноров (группа 1) и 5% детей контрольной группы (группа 3) также выявлены антитела активной фазы. Титр маркеров острой стадии инфекции (к VCA и EA) оказался очень высоким в сыворотках 4-ой группы (1:1600 и выше). Полученные нами данные совпадают с описанными в литературе. В настоящее время разработанные рекомбинантные антигены вируса Эпштейна-Барр рек-р18 (VCA) и рек-р54 (EA) проходят испытания при разработке тест-систем для диагностики острой фазы ВЭБ-инфекции с помощью ИФА.

Выявление «маркеров патогенности».

Разработка иммунофлуоресцентного метода диагностики цитомегаловирусной инфекции За рубежом, учитывая неоднозначность и сложность диагностики, в настоящее время диагноз острой цитомегаловирусной инфекции ставят при наличии 3-х показателей.

Первый – выделение инфекционного вируса в культуре клеток, второй – выявление ДНК цитомегаловируса в исследуемом образце и третий – наличие рр65-антигенемии. Присутствие рр65-антигена в крови выявляют чаще всего с помощью меченых моноклональных или поликлональных антител к этому белку на поверхности периферических лейкоцитов.

Некоторые исследователи называют этот антиген лейкоцитарным антигеном или маркером патогенности.

Этот подход к диагностике острой цитомегалии появился в последние пять лет, хотя необходимость тестировать продуктивную ЦМВ-инфекцию в органах и тканях появилась давно. В этом направлении нами также были проведены исследования. Для этого были получены гипериммунные кроличьи антисыворотки к нашим рекомбинантным белкам рек-рр150, рек-IE2 и рек-рр65 еще до того, как в научной литературе появился критерий рр65-антигенемии. Антисыворотки метили ФИТЦ (флуоресцеинизотиоцианатом).

Иммуногистохимический анализ проводили на препаратах клеток, зараженных ЦМВ c 1го по 10-й день от момента заражения. Специфическое свечение наблюдали, начиная с 5-х суток. Максимальное свечение наблюдалось на 7-е сутки после инфицирования. В дальнейшем происходило разрушение монослоя за счет цитопатического действия ЦМВ. Контрольные препараты с незараженным монослоем после обработки флуоресцентными антисыворотками специфического свечения не показывали.

К нашему сожалению, у нас не было технических возможностей диагностировать острую цитомегаловирусную инфекцию, но нами была проведена работа по выявлению связи герпесвирусов с атеросклерозом у больных с ишемической болезнью сердца, подвергшимся аортокоронарному шунтированию.

–  –  –

Для проведения этого исследования была выбрана группа пациентов с ишемической болезнью сердца и выраженным атеросклерозом коронарных сосудов. Всем пациентам группы была проведена хирургическая операция аортокоронарного шунтирования, во время которой у всех больных выявлены обширные атеросклеротические повреждения сосудов сердца. Во время операции у всех пациентов брали поврежденные атеросклеротическими бляшками и неповрежденные фрагменты коронарных сосудов, аорты и прилежащих тканей.

–  –  –

Анализ in situ биопсийного материала показал, что после обработки срезов полученными мечеными антисыворотками практически во всех пробах наблюдается специфическое свечение. Почти во всех биопсийных образцах было выявлено специфическое свечение в стенках мелких сосудов и vasa vasorum (рис. 31). Важно отметить, что специфическое свечение всегда было связано с тканями, в которых располагались атеросклеротические бляшки (рис. 32), и лишь иногда с участками неповрежденных атеросклерозом тканей. В этих участках антисыворотка к рек-рр65 показывала более значительный уровень свечения в сравнении с другими мечеными антисыворотками. Это является, на наш взгляд, дополнительным доказательством продуктивной формы ЦМВ-инфекции в тканях сердца, которое придерживается подавляющим числом авторов, считающих белок рекрр65 «маркером патогенности». Именно его появление в ткани связывают с продуктивной формой цитомегаловирусной инфекции. Таким образом, в ходе своих исследований мы создали третий необходимый компонент для диагностики острой цитомегаловирусной инфекции – белок рек-рр65.

Конструирование панели сывороток, содержащих и не содержащих антитела класса G к цитомегаловирусу человека При создании панели было проверено 2340 образцов сывороток от разных доноров. Сыворотки готовили сразу после забора крови. Хранили до использования при -180С.

Из них отбирались образцы янтарного цвета, прозрачные на свету, не содержащие антитела и антигены к другим вирусным инфекциям (гепатит C, гепатит B, ВИЧ 1/2, сифилис, герпес 1,2 типа и хламидиоз). Для этого каждый образец проверяли на наличие антител к перечисленным инфекциям. Затем отбирались сыворотки, показывающие одинаковые результаты на ИФА-тест-системах зарубежного производства: СМV – IgG -ELISA PКS MEDAC, СМV - IgG-EIA recombCOBAS-core, выявляющих специфичные к ЦМВ антитела. Для панели отбирались отрицательные сыворотки с оптической плотностью не выше 0,15 о.е. Положительные образцы должны были иметь титр антител не ниже 1:200 и ОП не менее 0,5 о.е. Таким образом, было отобрано 40 сывороток. Все отобранные сыворотки проверяли методом ПЦР на присутствие ДНК цитомегаловируса. Все исследуемые образцы показали отрицательный результат на наличие антител класса М к ЦМВ.

На основе литературных данных и результатов собственных исследований была сформулирована модель стандартной панели:

1. Положительные референс-панели предназначены для контроля чувствительности и стабильности диагностических систем.

2. Отрицательные референс-панели предназначены для контроля специфичности и стабильности диагностических систем.

Из этого следует, что в положительной референс-панели часть сывороток должна содержать концентрацию специфических к ЦМВ антител, которая обуславливает минимальный аналитический сигнал для контроля чувствительности коммерческих тестсистем. Также в панели должны присутствовать и сыворотки с высоким содержанием вирусспецифических антител, для того чтобы контролировать эффект «перенасыщения», который появляется иногда при конкурентных постановках анализа антител.

Таблица 10 Аттестация лиофилизированных сывороток, входящих в состав стандартной панели (сыворотки, не содержащие антитела к ЦМВ).

–  –  –

Для удобства использования панели из 24 положительных сывороток, содержащих антитела IgG к ЦМВ, оставили только 20 положительных сывороток. Так как сыво

–  –  –

На основании проведенных исследований, подтвердивших показатели иммуноферментной активности лиофилизированных сывороток при хранении в различных температурных условиях, стабильность физико-химических свойств сывороток, отобранные 36 сывороток были аттестованы в качестве стандартной панели сывороток, содержащих и не содержащих антитела класса G к ЦМВ. На панель разработаны и утверждены свидетельство и инструкция по применению. Стандартная панель внесена в Реестр национальных стандартных образцов РФ под номером: ОСО 42-28-360-01.

Выявление генетических маркеров При выборе районов генов герпесвирусов в качестве генетических маркеров мы основывались на следующих принципах: во-первых, и самое важное, это максимальное количество последовательностей выбираемого района различных штаммов и изолятов, депонированных в базах данных. Анализ баз данных показал, как правило, последовательность какого-либо района генома герпесвирусов представлена из 3-5 штаммов и изолятов, редко из 10-12. Поэтому, чтобы составить картину изменчивости геномов среди выявляемых изолятов мы выбирали район по максимальной представленности его в базах данных. Во-вторых, выбранный район должен кодировать функционально важный для вируса белок, и, в-третьих, выбранный район должен иметь минимальную гомологию с аналогами других герпесвирусов.

-Герпесвирусы Вирусы простого герпеса 1 и 2 типа Анализ международных баз данных показал, что нуклеотидные последовательности геномов ВПГ в базах представлены ограниченным количеством штаммов и изолятов.

Для ВПГ-1 – это 6 штаммов и 5 клинических изолятов, а для ВПГ-2 – это 7 штаммов и 6 клинических изолятов. Для выявления генетических маркеров вирусов простого герпеса задачей своего исследования мы определили выявление ДНК ВПГ 1 и 2 типа с высокой степенью специфичности в клинических образцах, ограничиваясь одноступенчатой процедурой проведения ПЦР. Поставленная задача решалась посредством подбора уникальных олигонуклеотидов-праймеров для амплификации фрагментов генов UL44 (ВПГ-2) и US-6 (ВПГ-1), кодирующих аминокислотные последовательности гликопротеинов С и D.

Продукты ПЦР анализировали электрофорезом в 2% агарозном геле. О положительной реакции судили по полосе ампликона, соответствующей размеру 395 п. о. - для ВПГ-1 и 392 п. о. – для ВПГ-2. Кроме того, были проведены ПЦР с градиентами температуры отжига: 560-640С для ВПГ-1 и 580–670С для ВПГ-2. Электрофорезы продуктов проведенных реакций показали следующее: как в случае ВПГ-1 (рис. 33), так и в случае ВПГрис. 34) присутствуют только теоретически рассчитанные ампликоны при всех температурах, выбранных для градиентов.

501, 489 Рис. 33. Электрофореграмма амплифицируемого фрагмента ВПГ-1. 1-8 - градиент температуры отжига 560-640С, 9 - маркер pUC19/MspI (справа размеры рестрикционных фрагментов, пар оснований).

501, 489 Рис. 34. Электрофореграмма амплифицируемого фрагмента ВПГ-2. 2-11 - градиент температуры отжига 580–670С, 1, 12 - маркер pUC19/MspI (слева размеры рестрикционных фрагментов, пар оснований).

C использованием разработанных олигонуклеотидов-праймеров было проведено ПЦР-обследование 238 человек по поводу рецидивирующего генитального герпеса, при отсутствии клинических проявлений генитального герпеса, имеющих проблемы фертильности и вынашивания беременности. При этом у каждого из пациентов неоднократно исследовали плазму крови, материал морфологических элементов, соскоб из цервикального канала, сперму как в период обострения, при рецидивирующем герпесе, так и в стадии ремиссии.

У 121 человека результаты ПЦР-обследования были положительны. В табл. 12 приведены результаты выявления ДНК ВПГ-1 и ВПГ-2 у этих пациентов.

–  –  –

Из приведенных данных видно, что ДНК только ВПГ-2 была выявлена в 63% случаев, а ДНК только ВПГ-1 у 26% обследованных пациентов. При этом совместное выявление ДНК обоих типов составило 11%. Полученные результаты показывают, что причиной генитального герпеса чаще бывает ВПГ-2, встречаемость ВПГ-1 значительно ниже.

Однако в 11% случаев выявляются вирусы и 1-го и 2-го типа. Полученные результаты подтверждают этиологическую роль каждого из вирусов простого герпеса 1 и 2 типов в патогенезе генитального герпеса и наличие смешанного типа инфекции. Очевидно, что причиной фертильности и невынашивания беременности может стать вирус простого герпеса и чаще 2-го типа.

Вирус ветряной оспы и опоясывающего лишая Поставленную задачу решали посредством подбора уникальных праймеров для амплификации фрагмента гена UL36 генома ВВО, кодирующего тимидинкиназу, для которого было найдено наибольшее количество нуклеотидных последовательностей из 5 штаммов и 10 клинических изолятов, депонированных в международных базах нуклеотидных данных.

Рис. 35. Определение ДНК вируса ветряной оспы и опоясывающего лишая в клинических образцах.

ПЦР-продукт был подвергнут электрофорезу в агарозном геле. О положительной реакции судили по полосе ампликона, соответствующей размеру 394 п.о. На рис. 35 на электрофореграмме показано расположение ампликона, соответствующего амплифицируемому гену UL36.

-Герпесвирусы Цитомегаловирус человека Был изучен район генома ЦМВ, кодирующий гликопротеин B (gB) вирусной оболочки (ген UL55). Обнаружено 70 нуклеотидных последовательностей, кодирующих Nконцевую часть белка gB, различных вариантов ЦМВ. На рис. 36 показана электрофореграмма продуктов (244 п. н.) полимеразной цепной реакции ДНК цитомегаловируса при градиенте температуры отжига 570-650С.

–  –  –

Рис. 36. Электрофореграмма амплифицируемого фрагмента цитомегаловируса в 2%- ном агарозном геле.

Дорожки 1–10 – градиент температуры отжига 57–650С; дорожки М – маркер 100–1500 п.н. (СибЭнзим, Новосибирск); дорожки 12–17 – ПЦР ДНК герпесвирусов ВПГ-1, 2 (штаммы HF и MS из ATCC соответственно), ВВО (штамм Ellien из ATCC), EBV (штамм Raji из ATCC), ЦМВ (штамм AD-169 из ATCC), HHV-6 (штамм Z29 из ATCC); дорожки 19–20 – электрофорез продуктов ПЦРанализа клинических образцов.

В данной работе проанализировано значительное количество последовательностей гена UL55 ЦМВ - 70 депонированных последовательностей N-концевой части гена из различных регионов мира. Это позволяет надеяться, что выявленная тенденция внутривидовой изменчивости выбранного района генома будет сохраняться и предлагаемые праймеры будут выявлять ДНК ЦМВ во всех случаях этой инфекции. ПЦР-анализ нескольких сотен клинических образцов в случае положительной реакции всегда выявлял продукт размером 244 п.н. Таким образом, предлагаемую нами пару праймеров можно использовать для автоматического секвенирования ДНК ЦМВ из клинических образцов и определять штаммовую принадлежность региональных вирусных изолятов. Кроме того, предлагаемые праймеры могут стать основой для создания биочипа, позволяющего тестировать различные штаммы и генотипы цитомегаловируса человека.

Вирус герпеса человека 6 типа В качестве гена-мишени нами был выбран ген U11, кодирующий белок р100.

Этот белок является жизненно важным белком для репликации ВГЧ-6 и не может быть делетирован или модифицирован в жизнеспособном вирусе. Поэтому область генома, кодирующая этот структурный вирусный белок может являться маркерной для ПЦРдиагностики. В геноме штамма Z29 (B-тип) для дизайна праймеров был выбран район гена U11 с координатами 21884–22289 н.о. Этот район гена имеет размер 405 п.о. и 96% гомологии с ВГЧ-6A (% гомологии для всего гена U11 – 88%).

–  –  –

Рис. 37. Результаты ПЦР-анализа клинических образцов (электрофорез в 1% агарозном геле). 2–7 – примеры ПЦР клинических образцов, полученных от детей с диагнозом внезапная экзантема; 8–9 – ПЦР клинических образцов, полученных от пациентов с диагнозом СПИД; 11–13 – ПЦР сывороток, полученных от пациентов с диагнозом синдром хронической усталости; 1, 10, 14 – 100 bp ДНК-маркер.

Электрофоретический анализ продуктов реакции при градиенте температуры отжига показал, что температура отжига может варьировать в пределах от 49,20С до 58,40С без существенного изменения интенсивности ПЦР-сигнала. Достаточно широкий интервал температур отжига позволяет проводить ПЦР на различных моделях отечественных и зарубежных амплификаторов. Чувствительность реакции составила 1ТЦД50. В итоге нами были разработаны олигонуклеотиды-праймеры и оптимальные условия по использованию ПЦР для диагностики герпесвирусной инфекции ВГЧ-6 (рис. 37).

-Герпесвирусы Вирус Эпштейна-Барр Поставленную задачу решали посредством подбора уникальных праймеров для амплификации фрагмента гена BKRF1, кодирующего EBNA1, для которого было найдено наибольшее количество нуклеотидных последовательностей известных штаммов и клинических изолятов, учитывая факт стабильности этого белка в инфицированных тканях во всех случаях выявления ВЭБ-инфекции. Для выявления гомологий ДНК ВЭБ были проанализированы консервативные участки генов, кодирующих основные белки, и из большого массива базы данных «GeneBank» был выбран участок гена BKRF1 ВЭБ с 27 по 538 н.о. (по наибольшему числу сопоставимых гомологий).

Секвенирование и рестрикционный анализ ПЦР-продукта (рис. 38) подтвердил полное соответствие нуклеотидной последовательности выбранному участку гена BKRF1.

–  –  –

Разработка универсальных программ (температурно-временных профилей) для ПЦР-диагностики герпесвирусов человека В рамках проведения работ по диагностике генитального герпеса мы столкнулись со значительным количеством клинических образцов. Это - и кровь, и соскобы из цервикального канала, и образцы спермы, и корочки, и содержимое морфологических элементов. Поэтому использование индивидуальных условий амплификации для каждого вида возбудителя герпеса (ВПГ-1, ВПГ-2 и ЦМВ) оказалось бы мало производительным решением. Кроме того, нам пришлось разработать и праймеры для дифференциальной ПЦРдиагностики Clamydia trachomatis, Ureaplasma urealyticum и Mycoplasma hominis (данные в диссертации не указаны).

По этим соображениям для использования предлагаемых праймеров в диагностике герпесвирусов человека мы разработали универсальные условия диагностической амплификации. Для этого на реактивах различных серий и различных производителей проводили амплификацию с различными градиентами температур отжига. Анализ этой работы позволил всю разработанную ПЦР-диагностику проводить по двум программ, а не по уникальным для каждой пары праймеров.

–  –  –

На рис. 39 показана картина электрофореза диагностической ПЦР, проведенной по этим двум программам.

Таким образом, была разработана ПЦР-диагностика ДНК ВПГ-1, ВПГ-2, ВВО, ВЭБ, ЦМВ и ВГЧ-6. Проведена апробация на вирусных референс-штаммах из коллекции АТСС. Создан универсальный подход в виде двух программ для ПЦР ДНК этих вирусов.

ВЫВОДЫ

1. Создана серия экспрессирующих плазмидных конструкций, с фрагментами генов герпесвирусов человека 1-6 типов, обеспечивающих в клетках E. coli синтез рекомбинантных белков, содержащих выявленные с помощью компьютерного анализа антигенные детерминанты. Плазмидные конструкции обеспечивали синтез в клетках бактерий следующих рекомбинантных белков - 1) рек-gD-1 и рек-gG-2, содержащих иммунодоминантные области гликопротеина D ВПГ-1 и гликопротеина G ВПГ-2; 2) рек-gЕ, содержащего иммунодоминантную область гликопротеина Е вируса ВВО; 3) рек-рр150, рек-р52 и рекрр65, содержащих иммунодоминантные области главного матричного фосфопротеина рр150, ДНК-связывающего белка р52 и тегументного фосфопротеина рр65 цитомегаловируса; 4) рек-р100 и рек-р41, содержащих иммунодоминантные области белков р100 и р41 вируса герпеса человека 6-го типа; 5) рек-р18 и рек-р54, содержащих иммунодоминантные области белков р18 и р54 вируса Эпштейна-Барр.

2. Создан бактериальный (E. coli) экспрессирующий вектор на основе плазмидной ДНК pUR290-6*his. Отличительными особенностями этой конструкции является кодирование шестигистидинового тракта (6His), который формирует на С-конце целевого рекомбинантного белка аффинную мишень для очистки полноразмерной копии белка на металлохелатных сорбентах, и биосинтез -галактозидазы, которая в конечной конструкции укорачивается до небольшого размера и обеспечивает высокий уровень сорбции белка на полистирольных планшетах.

3. Отработаны методы выделения рекомбинантных полипептидов, достаточной чистоты, для последующего их использования при выявлении методом ИФА в исследуемых сыворотках крови антител, специфичных к вирусам герпеса человека. Показано, что рекомбинантные полипептиды рек-gD-1 и рек-gG-2 (ВПГ); рек-gE (ВВО), рек-р52; рекрр65 и рек-рр150 (ЦМВ); рек-р100 и рек-рр41 (ВПГ-6); рек-р18 и рек-р54 (ВЭБ) могут быть использованы для иммуноферментного выявления в исследуемых сыворотках крови антител, специфичных соответствующим герпесвирусам человека 1-6 типа.

4. Флуоресцентные моноспецифические кроличьи антисыворотки, к рекомбинантным белкам рек-рр150, рек-IE2, рек-рр65 цитомегаловируса, обеспечивают выявление ЦМВ с помощью иммунофлуоресцентного анализа in situ.

5. Создана стандартная панель сывороток (№ ОСО 42-28-360-01) для контроля иммуноферментных диагностических тест-систем, выявляющих антитела к цитомегаловирусу человека.

6. Выявлены уникальные генетические маркеры вирусов герпеса человека 1-6 типов, локализованные в генах US-6 (ВПГ-1), UL44 (ВПГ-2), UL36 (ВВО), UL55 (ЦМВ), BKRF1 (ВЭБ) и U11 (ВГЧ-6). Амплификация методом ПЦР генетических маркеров с помощью рассчитанных олигонуклеотидных праймеров позволяет выявлять различные штаммы и клинические изоляты вирусов простого герпеса 1 и 2 типов, вируса ветряной оспы и опоясывающего лишая, цитомегаловируса, вируса Эпштейна-Барр и вируса герпеса человека 6-го типа.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

1. М.А.Суслопаров, П.А.Белавин, А.В.Крендельщиков, А.И.Бедристов М.М.Бахтина, В.В.Гуторов, И.В.Бабкин, А.А.Чепурнов. “Клонирование и определение первичной структуры генов белков IE2 и pp150 цитомегаловируса человека (HCMV)//Молекулярная генетика, микробиология и вирусология, 1996, N1, стр. 32Суслопаров М. А., Суслопаров И. М., Плясунов И. В., Бахтина М. М., Сафронов П.

Ф., Гришаев М. П., Блинов В. М., Иванькина Т. Ю. «Получение рекомбинантного антигена белка p52 цитомегаловируса человека (HCMV).» // Мол. генетика, микробиология и вирусология, 2000, № 4, стр. 24-29.

3. Суслопаров И. М., Суслопаров М. А., Ивченко С. Н., Гришаев М. П., Смердова М.

А., Косова Е.Ю., Блинов В. М., Сараев Д. В., Махова Н. М., Носкова Н. В. “Конструирование рекомбинантного антигена pp65 цитомегаловируса человека и исследование его иммунохимических свойств» // Молекулярная генетика, микробиология и вирусология, 2005, № 2, стр. 28-32.

4. Ивченко С. Н., Суслопаров И. М., Масычева В. И., Суслопаров М. А., Мезенцев А.Н. “Конструирование жидкой панели сывороток, содержащих и не содержащих антитела класса IgG к цитомегаловирусу человека”. // Вестник Российской академии медицинских наук, 2004, №8, стр.37-39.

5. Ивченко С.Н., Суслопаров И.М., Масычева В.И., Суслопаров М.А., Лосев М.В. «Разработка иммуноферментной тест-системы для определения антител в сыворотке крови к цитомегаловирусу человека».// Сибирский медицинский журнал, 2005, №2(том 20), стр. 53-55.

6. Леган М.В., Чернявский А.М., Мироненко С.П., Слайковская Л.Е., Литасова Е.Е., Лукьянчикова Н.Л., Кайдорин А.Г., Суслопаров М.А., Махова Н.М. «Выявление герпесвирусов в крови пациентов с кардиоваскулярной патологией». // Клиническая лабораторная диагностика, №4, 2003, стр.48-49.

7. И. М. Суслопаров, М. А. Суслопаров, Н. М. Махова, Т. Ю. Загоруйко, Н. В. Носкова. «Выявление ДНК цитомегаловируса человека (Human cytomegalovirus) с помощью ПЦР» // Биотехнология, 2004, №6, С. 76-82.

8. Суслопаров И. М., Плясунов И. В., Сафронов П. Ф., Бахтина М. М., Махова Н. М., Локтева Л. А., Гришаев М. П., Суслопаров М. А. «Разработка и получение рекомбинантного антигена gD вируса простого герпеса 1-го типа (HSV-1).» / Мол. генетика, микробиология и вирусология, 2001, №2, стр. 34-37.

9. Суслопаров И. М., Суслопаров М. А., Жукова А. В., Махова Н. М., Носкова Н. В., Терещенко А. Ю., Смердова М. А., Гришаев М. П., Бечикова А. В. “Конструирование рекомбинантного антигена gE вируса ветряной оспы и опоясывающего лишая и исследование его иммунохимических свойств”. // Биотехнология, 2004, №4, С.

83-89.

10. Суслопаров М. А., Суслопаров И. М., Плясунов И.B., Локтева Л. А., Бахтина М. М., Махова Н. М., Данилюк Н. К., Смердова М. А., Лобанова В. В., Гришаев М. П., Терещенко А. Ю.. “Конструирование рекомбинантных антигенов вируса ЭпштейнаБарр и исследование их иммунохимических свойств”.// Биотехнология, 2004, №5, С. 87-94.

11. Плясунов И.B., Суслопаров М.А., Суслопаров И.М., Бахтина М.М., Махова Н.М., Гришаев М. П., Терещенко А.Н., Смердова М.А.. «Получение рекомбинантного антигена р100 герпесвируса человека 6–го типа».// Биотехнология, 2004, №6, С. 83И.B. Плясунов, М.А. Суслопаров, М.М. Бахтина, И.М. Суслопаров, Н.М. Махова, Н.В. Носкова, О. Ю. Федоренко, А. В. Бечикова. “Использование метода полимеразной цепной реакции для выявления ДНК вируса герпеса человека 6-го типа (Human herpes virus 6 type, HHV6)”// Биотехнология, 2005, №1, с. 83-89.

13. Суслопаров М.А., Махова Н.М., Носкова Н.В., Плясунов И.В., Суслопаров И.М., Сергеев А.Н., Шерстобоев Е.Ю., Мартюшев-Поклад А.В., Сергеева С.А., Эпштейн О.И., Глотов А.Г., Глотова Т.И. “Изучение эффективности лечебнопрофилактического действия сверхмалых доз антител к гамма-интерферону на экспериментальной мышиной модели герпесвирусной инфекции.”// Антибиотики и химиотерапия. – 2004. - № 10. – С. 3-6.

14. Суслопаров М. А., Суслопаров И. М., Махова Н. М., Омигов В. В., Литасова Е.Е., Леган М.В., Слайковская Л.Е., Мироненко С.П., Чернявский А.М., Лукьянчикова Н. Л. “Исследование маркеров герпесвирусных инфекций при ишемической болезни сердца (ИБС) ”// Молекулярная генетика, микробиология и вирусология, №4, 2005, стр.36-40..

15. М. А. Суслопаров, И. М. Суслопаров, Т. Ю. Загоруйко, Н. В. Носкова, Н. М. Махова. “Выявление ДНК вирусов простого герпеса 1 и 2 типов (Herpes simplex virus 1, 2 type) с помощью ПЦР при генитальном герпесе”// Молекулярная генетика, микробиология и вирусология, 2006, принята в печать.

16. Суслопаров М.А. " Рекомбинантная плазмидная ДНК pUL 32 HCMV, обеспечивающая экспрессию фрагмента гена UL32 цитомегаловируса человека, кодирующего гидрофильную часть основного матричного белка pp150, в клетках бактерий E. coli"//Патент РФ № 2151801 от 28.07.1998 г., БИ № 18 от 27.06.2000 г.

17. Суслопаров М.А., Суслопаров И.М., Плясунов И.В. "Фрагмент гена UL44 цитомегаловируса человека, кодирующий иммунодоминантную часть белка р52, и рекомбинантная плазмидная ДНК pUL44 HCMV, обеспечивающая экспрессию фрагмента гена UL44 цитомегаловируса человека в клетках бактерий E. coli" // Патент РФ № 2151800 от 28.07.1998 г, БИ № 18 от 27.06.2000 г.

18. Суслопаров М.А., Суслопаров И.М., Плясунов И.В." Рекомбинантная плазмидная ДНК pHSVD1, обеспечивающая экспрессию фрагмента гена US6 вируса простого герпеса 1 типа человека, кодирующего иммунодоминантную часть гликопротеина Д этого вируса, в клетках бактерий E. coli"// Патент РФ № 2178806 от 21.01.2000 г, БИ №3 от 27.01. 2002 г.

19. Суслопаров М.А., Бахтина М.М., Суслопаров И.М., Махова Н.М., Плясунов И.В., Локтева Л.А." Рекомбинантная плазмидная ДНК pU11HHV6, обеспечивающая экспрессию фрагмента гена U11 герпесвируса человека 6 типа, кодирующего иммунодоминантную часть белка тегумента р100, в клетках бактерий E.coli" Патент РФ № 2189393 от 20.03.2000 г, БИ № 26 от 20.09.2002 г.

20. Суслопаров М.А., Плясунов И.В., Бахтина М.М., Суслопаров И.М., Махова Н.М."

Рекомбинантная плазмидная ДНК pU27HHV6, обеспечивающая экспрессию фрагмента гена U27 герпесвируса человека 6 типа, кодирующего имунодоминантную часть белка р41, в клетках бактерий E.coli" Патент РФ № 2201450 от 25.06.2001 г, БИ № 9 от 27.03.2003 г.

21. Суслопаров М.А., Суслопаров И.М." Рекомбинантная плазмидная ДНК pUL83HCMV, обеспечивающая экспрессию в клетках бактерий E.coli рекомбинантного белка, содержащего иммунодоминантную часть фосфопротеина рр65 HCMV и фрагмент бета-галактозидазы"// Патент РФ № 2218408 от 05.11.2001 г, БИ № 34 от 10.12.2003 г.

22. Суслопаров М.А., Суслопаров И.М., Махова Н.М., Плясунов И.В., Бахтина М.М. " Синтетические олигонуклеотиды - праймеры, используемые для выявления ДНК цитомегаловируса человека"// Патент РФ № 2164945 от 07.12.1999 г, БИ № 10 от 10.04.2001 г.

23. Суслопаров М.А., Суслопаров И.М., Махова Н.М.. Плясунов И.В.. Бахтина М.М."

Синтетические олигонуклеотиды-праймеры, используемые для выявления для выявления ДНК вируса простого герпеса 1 типа человека"// Патент РФ № 2165977 от 07.12.1999 г, БИ № 12 от 27.04.2001 г.

24. Суслопаров М.А., Суслопаров И.М., Загоруйко Т.Ю.. Махова Н.М." Синтетические олигонуклеотиды-праймеры, используемые для выявления ДНК вируса простого герпеса 2 типа человека"// Патент РФ № 2196179 от 07.03.2001 г, БИ № 1 от 10.01.2003 г.

25. Суслопаров М.А., Плясунов И.В., Бахтина М.М, Суслопаров И.М.. Махова Н.М."

Пара синтетических олигонуклеотидов-праймеров, используемых для выявления ДНК вируса простого герпеса человека 6 типа"// Патент РФ № 2193067 от 05.07.2001 г, БИ № 32 от 20.11.2002 г.

–  –  –



Похожие работы:

«АДМИНИСТРАЦИЯ АКСАЙСКОГО РАЙОНА ПОСТАНОВЛЕНИЕ № 13. 10. 2016 461 г. Аксай Об утверждении административного регламента по предоставлению муниципальной услуги "Расторжение договора аренды, безвозмездного пользования земельным участком" В соответств...»

«Хайрутдинов Ильдар Зиннурович ЭКОЛОГИЯ РЕПТИЛИЙ УРБАНИЗИРОВАННЫХ ТЕРРИТОРИЙ (НА ПРИМЕРЕ г. КАЗАНИ) 03.02.08 – экология (биологические науки) Автореферат диссертации на соискание ученой степени кандидата биологических наук КАЗАНЬ – 2010 Работ...»

«Институт законодательства и сравнительного правоведения при Правительстве Российской Федерации ЗАКОНОДАТЕЛЬСТВО О РЫБОЛОВСТВЕ И СОХРАНЕНИИ ВОДНЫХ БИОЛОГИЧЕСКИХ РЕСУРСОВ В ВОПРОСАХ И ОТВЕТАХ НАУЧНО-ПРАКТИЧЕСКОЕ ПОСОБИЕ Руководитель авторского коллектива кандидат юридических на...»

«УДК 544.6 ВЛАГОПЕРЕНОС В БИКОМПОНЕНТНЫХ КОНСЕРВАЦИОННЫХ МАТЕРИАЛАХ НА БАЗЕ НЕПОЛЯРНЫХ РАСТВОРИТЕЛЕЙ Н. Е. Беспалько Кафедра "Безопасность жизнедеятельности и военная подготовка", ФГБОУ ВПО "ТГТУ"; bgd@mail.nnn.tstu.ru Ключевые слова и фразы: амиды; а...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "ТЮМЕНСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ" Институт наук...»

«Бакшеева Юлия Витальевна ИССЛЕДОВАНИЕ ПРОСТРАНСТВЕННО-ЧАСТОТНЫХ СВОЙСТВ СИГНАЛОВ В УЛЬТРАЗВУКОВЫХ СИСТЕМАХ ДИАГНОСТИКИ БИОЛОГИЧЕСКИХ ОБЪЕКТОВ Специальность: 05.13.01 "Системный анализ, управление и обработка информации (в техн...»

«Иванова Ольга Ярославовна УЧАСТИЕ КАНОНИЧЕСКОГО СИГНАЛЬНОГО ПУТИ WNT В РЕГУЛЯЦИИ ПЛАСТИЧНОСТИ ГИППОКАМПА Специальность 03.03.01 – "Физиология" Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: кандидат биологиче...»

«Ельчининова О.А. Мышьяк в почвах долины Катуни и над месторождениями ртути 1. / М.А. Мальгин, А.В. Пузанов, О.А. Ельчининова, Т.А. Горюнова // Сибирский экологический журнал. -1993.№ 2 Ельчининова О.А. Тяжелые металлы и мышьяк в дикорастущих лекарственных 2. растениях Алтая / М.А. Мальгин, О...»

«Чайник электрический RK-M134 АНТИ АР Г Я М В ЕС ЯЦЕ РУКОВОДСТВО ПО ЭКСПЛУАТАЦИИ УВАЖАЕМЫЙ ПОКУПАТЕЛЬ! Благодарим вас за то, что вы отдали предпочтение бытовой технике компании REDMOND. REDMOND — это новейшие разработки, качество, надежнос...»

«МБОУ "Анабарская улусная гимназия"ОБСУЖДЕНО СОГЛАСОВАНО УТВЕРЖДАЮ На заседание МО зам директора по УНР директор школы Естественно-математического цикла Герасимова Н.И. Матвеева В.А._ Торокова А.П._ "_"_2015 г "_"_2015г. "_" 2015 г. РАБОЧАЯ УЧ...»

«НАЗАРЕНКО Александр Владимирович СИСТЕМА ПОВЫШЕНИЯ КАЧЕСТВА КОМПЕТЕНТНОСТНО-ОРИЕНТИРОВАННОГО ЭКОЛОГИЧЕСКОГО ПРОФЕССИОНАЛЬНОПЕДАГОГИЧЕСКОГО ОБРАЗОВАНИЯ 13.00.08 – Теория и методика профессиональ...»

«Динозавры: назад в прошлое, предсказывая будущее. Тема урока: Назад в прошлое, предсказывая будущее"Цели урока: Образовательные формировать представления детей о далеком прошлом Земли;пополнить знания учащихся об эпохе динозавров;уметь сравнивать две эпохи;познакомить с видами удивительных животны...»

«Министерство образования Республики Беларусь Учреждение образования "Международный государственный экологический университет имени А. Д. Сахарова" А. С. Шиляев С. П. Кундас А. С. Стукин ФИЗИЧЕСКИЕ ОСНОВЫ ПРИМЕНЕНИЯ УЛЬТРАЗВУК...»

«МЭФ "КАСПИЙСКИЙ ДИАЛОГ, 2017". ПОСТРЕЛИЗ. 14 апреля 2017 года в Москве в МГИМО МИД России состоялся Юбилейный Десятый Международный Экономический Форум "Каспийский диалог". Форум "Каспийский диалог" про...»

«Вестник Томского государственного университета. Биология. 2013. № 4 (24). С. 77–97 УДК [597.6+598.1](571.1) Л.А. Эпова1, В.Н. Куранова2, С.Г. Бабина1 Государственный природный заповедник "Кузнецкий Алатау" (г. Междуреченск) Томский государственный университет (г. Томск) ВИДОВОЕ РАЗНООБРАЗИЕ, БИОТОПИЧЕСКОЕ РАСПРЕДЕЛЕНИЕ И ЧИСЛЕННОСТЬ ЗЕМНО...»

«АДМИНИСТРАЦИЯ АКСАЙСКОГО РАЙОНА ПОСТАНОВЛЕНИЕ № 12. 10. 2016 459 г. Аксай Об утверждении административного регламента по предоставлению муниципальной услуги "Устранение технических ошибок в правоустанавливающих документах о предоставлении земельного участка, принятых органами местного сам...»

«For Official Use ENV/EPOC/EAP/MIN(2004)2 Organisation de Coopration et de Dveloppement Economiques Organisation for Economic Co-operation and Development _ _ Russian Or. English ENVIRONMENT DIRECTORATE ENVIRONMENT POLICY COMMITTEE For Official Use ENV/EPOC/EAP/MIN...»

«Самарская Лука: проблемы региональной и глобальной экологии. Самарская Лука. 2009. – Т. 18, № 1. – С. 119-126. УДК 591.5:598.113.6 ЖИВОРОДЯЩАЯ ЯЩЕРИЦА, LACERTA VIVIPARA, КАК ИНТЕГРАЦИОННАЯ МОДЕЛЬ БИОЛОГИЧЕСКИХ ИССЛЕДОВАНИЙ © 2009 Д.В. Семенов Институт проблем экологии и эволюции им....»

«Всероссийская научно-практическая конференция "Экология и безопасность в техносфере: современные проблемы и пути решения" ванные системы по управлению пожарно-спасательными формированиями, прогнозированию опасных факторов и чрезвычайных ситуаций. В МЧС России создана система...»

«8.2016 СОДЕРЖАНИЕ CONTENTS ПОЧВОВЕДЕНИЕ SOIL SCIENCE Воропаев В. Н., Астахов Ю. А. Мониторинг содер Voropaev V. N., Astakhov Yu. A. Monitoring of the жания меди в почвах реперных участков. 2 copper content in reference sites of soils. 2 Хамидов М. Х., Жураев У. А. Влияние орошения Khamidov M., Jurayev U. A. Influence of...»

«Андреева Юлия Викторовна МОРФОЛОГИЧЕСКИЙ АНАЛИЗ ПАЛЕАРКТИЧЕСКИХ ВИДОВ МАЛЯРИЙНЫХ КОМАРОВ КОМПЛЕКСА "ANOPHELES MACULIPENNIS" (DIPTERA, CULICIDAE) 03.00.08 – зоология Автореферат диссертации на соискание ученой степени кандидата биологических наук Томск – 2007 Работа выполнена в Научно...»

«Номер: KZ61VCY00072512 Дата: 15.07.2016 АЗАСТАН РЕСПУБЛИКАСЫ МИНИСТЕРСТВО ЭНЕРГЕТИКИ ЭНЕРГЕТИКА МИНИСТРЛІГІ РЕСПУБЛИКА КАЗАХСТАН МНАЙ-ГАЗ КЕШЕНДЕГІ КОМИТЕТ ЭКОЛОГИЧЕСКОГО ЭКОЛОГИЯЛЫ РЕТТЕУ, РЕГУЛИРОВАНИЯ, КОНТРОЛЯ И...»

«Классный час Покормите птиц зимой! Цель: Вызвать сочувствие к зимующим птицам. Научить проявлять заботу к ним. Расширить знания детей о птицах.Задачи: Формирование экологического представления детей об окружающем мире. Обобщить и расширить представления детей о зимующих птицах. В...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования "ТЮМЕНСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ" Институт биологии Кафедра зоологии и эволюционной экологии жив...»

«Ученые записки Крымского федерального университета имени В. И. Вернадского Серия "Биология, химия". Том 1 (67). 2015. № 3. С. 49–55. УДК 579.64:581.14(653.63) ВЛИЯНИЕ МИКРОБНОГО ПРЕПАРАТА "ЭМБИКО" НА ПРОРАСТАНИЕ СЕМЯН ОГУРЦОВ (CUCUMIS SATIVUS L.) СОРТОВ КОНКУРЕНТ И ФЕНИКС Татаренко Я. И., Отурина И. П., Теплицкая Л. М....»








 
2017 www.kn.lib-i.ru - «Бесплатная электронная библиотека - различные ресурсы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.